Review



cell lines hct116 atcc cat  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 97
      Buy from Supplier

    Structured Review

    ATCC cell lines hct116 atcc cat
    Cell Lines Hct116 Atcc Cat, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 2040 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+hct116+atcc+cat/RKO/pm41630900-172-147-150
    Average 97 stars, based on 2040 article reviews
    cell lines hct116 atcc cat - by Bioz Stars, 2026-09
    97/100 stars

    Images

    Related Articles

    other:

    Article Title: A nuclear isoform of hydroxyacyl-COA dehydrogenase inhibits tumor progression in colorectal cancer.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies FLAG tag Cell Signaling Technology Cat#14793 HA tag Cell Signaling Technology Cat#3724 HADH Proteintech Cat#19828-1-AP RRID:AB_10667408 Lamin B Cell Signaling Technology Cat#13435 RRID:AB_10896336 Tubulin Proteintech Cat#11224-1-AP RRID:AB_2210206 COX5A Abclonal Cat#A6437 RRID:AB_2767039 TOM20 Abclonal Cat#A19403 RRID:AB_2862646 Chemicals, peptides, and recombinant proteins Lipofectamine 3000 Invitrogen Cat#L3000015 Puromycin Selleck Cat#S7417 Fetal bovine serum (FBS) GIBCO Cat#26140079 Dulbecco’s modified Eagle’s medium (DMEM) GIBCO Cat#11965092 Annexin V and Propidium Iodide eBioscience Cat#88-8007-72 Proteinase K NEB Cat#P8107S Mito-Tracker Red CMXRos Beyotime Cat#C1439S Critical commercial assays BD Pharmingen FITC Annexin V Apoptosis BD Biosciences Cat#556547 EdU detection kit Beyotime Cat#C0075L Nuclear and Cytoplasmic Protein Extraction Kit Beyotime Cat#P0027 Mitochondria Fractionation kit Beyotime Cat#ELS-ALX-850-276-KI01 Dual-Luciferase® Reporter Assay System Promega Cat#E1910 EZ-ChIP kit Merck Cat#17-371 Universal DNAseq Library Prep Kit KAITAI-BIO Cat#AT4106 Deposited data ChIP-seq This paper Gene Expression Omnibus: GSE253660 RNA-seq This paper Gene Expression Omnibus: GSE253660 Experimental models: Cell lines HCT116 ATCC Cat#CCL-247 RKO ATCC Cat#CRL-2577 HEK293T ATCC Cat#CRL-3216 Oligonucleotides HADH qPCR forward primer This paper ACTCGGGTTTGGGCTTTTCT HADH qPCR reverse primer This paper CCACCCATCCACGATGAACT AXIN2 qPCR forward primer This paper TAACCCCTCAGAGCGATGGA AXIN2 qPCR reverse primer This paper AGTTCCTCTCAGCAATCGGC Recombinant DNA pCDH3.1-FLAG-HADH-L This paper N/A pCDH3.1-FLAG-HADH-S This paper N/A CT-repeat-reporter This paper N/A Software and algorithms GraphPad Prism 8 GraphPad Software https://www.graphpad.com/ ImageJ National Institutes of Health (NIH) https://imagej.nih.gov/ij/ (Continued on next page) iScience 29, 114470, February 20, 2026 e1

    Article Title: Profiling the metabolism of human cells by deep 13 C labeling
    Article Snippet: Inc. Cat#GLC-018 Critical Commercial Assays Deposited Data Experimental Models: Cell Lines HCT116 ATCC Cat#ATCC ® CCL-247TM MCF7 ATCC Cat#ATCC ® HTB-22TM HeLa ECACC Cat#93021013 Experimental Models: Organisms/Strains Oligonucleotides Recombinant DNA Software and Algorithms mzAccess ( http://www.mzaccess.org/ ) (Lyutvinskiy et al. 2017) N/A Mathematica v10 Wolfram Research N/A GraphPad Prism version 7 software GraphPad Software N/A Other SnakeSkinTM Dialysis Tubing, 3.5K MWCO, 35 mm Thermo Fisher Scientific Cat#88244 Cell scraper with two-position blade, scraper length: 25 cm Sarstedt Cat#83.1830 Cell culture dish 10 cm Sarstedt Cat#83.1830 Cell culture plates, 6-well Sarstedt Cat#83.3920 Open in a separate window Key Resources Table Rich data on endogenous metabolites and active pathways from a single cell culture In HCT116 cancer cells, hundreds of synthesized metabolites were unknown Cells scavenge nutrients from serum and lack central synthesis pathways Branched-chain keto acids were metabolized and could substitute for amino acids Significance As cellular metabolism is increasingly recognized as a key factor for a range of human disorders, charting the metabolic activity of various human cell types is of great importance.

    Article Title: CircTBC1D22A inhibits the progression of colorectal cancer through autophagy regulated via miR-1825/ATG14 axis.
    Article Snippet: GSE108153 GEO https://www.ncbi.nlm.nih.gov/geo/ GSE8671 GEO https://www.ncbi.nlm.nih.gov/geo/ GEPIA dataset GEPIA http://gepia2.cancer-pku.cn/#index GSE252689 (circRNA-seq) This paper https://www.ncbi.nlm.nih.gov/geo/ query/acc.cgi?acc=GSE252689 Experimental models: Cell lines HCT116 ATCC Cat#CCL-247 LOVO ATCC Cat#CCL-229 SW620 ATCC Cat#CCL-227 CACO2 ATCC Cat#HTB-37 SW480 ATCC Cat#CCL-228 HCT15 ATCC Cat#CCL-225 RKO ATCC Cat#CRL-2577 HT29 ATCC Cat#HTB-38 (Continued on next page) 14 iScience 27, 109168, March 15, 2024

    Staining:

    Article Title: Opening of cohesin's SMC ring is essential for timely DNA replication and DNA loop formation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-Smc3 Bethyl Cat#A300-060A; RRID: AB_67579 Rabbit polyclonal anti-Smc1 Bethyl Cat#A300-055A; RRID: AB_2192467 Rabbit polyclonal anti-Rad21 Bethyl Cat#A300-080A; RRID: AB_2176615 Rabbit polyclonal anti-Wapl Kueng et al., 2006 N/A Rabbit polyclonal anti-Sororin Schmitz et al., 2007 N/A Rabbit polyclonal anti-Pds5A Bethyl Cat#A300-089A; RRID: AB_2162213 Goat polyclonal anti-Histone H3 (C-16) Santa Cruz Cat#Sc8654; RRID: AB_2118303 Mouse monoclonal anti-PCNA (PC10) Santa Cruz Cat#SC56; RRID: AB_628110 Rat monoclonal anti-HA (3F10) Roche Cat#11867423001; RRID: AB_390918 Mouse monoclonal anti-FLAG M2 Sigma-Aldrich Cat#F18041MG; RRID: AB_262044 Chicken polyclonal anti GFP Abcam Cat#ab13970; RRID: AB_300798 Rabbit monoclonal anti-p53 (EP42Y) Abcam Cat#ab239880; RRID: AB_1524137 Rabbit monoclonal anti-Phospho-SMC1 (D7S8Y) CST Cat#58052S; RRID: AB_2799538 Mouse monoclonal anti-Phospho-ATM (Ser1981) CST Cat#4526S; RRID: AB_2062663 Rabbit polyckonal anti-CHK1 (phospho S345) Genetex Cat#GTX100065; RRID: AB_1949975 Mouse monoclonal anti-H2A.X Phospho (Ser139) Biolegend Cat#613401; RRID: AB_315794 Anti-rabbit IgG (HRP-conjugated) GE Healthcare Cat#NA934V; RRID: AB_2722659 Anti-mouse IgG (HRP-conjugated) GE Healthcare Cat#NA931V; RRID: AB_772210 Anti-rat IgG (HRP-conjugated) GE Healthcare Cat#NA935; RRID: AB_772207 Anti-Chicken IgY, Alexa Fluor 488 Invitrogen Cat#A11039; RRID: AB_142924 Anti-Mouse IgG, Alexa Fluor 488 Invitrogen Cat#A21202; RRID: AB_141607 Anti-Rabbit IgG, Alexa Fluor 488 Invitrogen Cat#A11008; RRID: AB_143165 Chemicals, peptides, and recombinant proteins Thymidine Sigma-Aldrich Cat#T1895-5G Nocodazole Sigma-Aldrich Cat#M1404-10MG Aphidicolin Sigma-Aldrich Cat#M1404-10MG Camptothecin Sigma-Aldrich Cat#C9911-100MG Mirin Sigma-Aldrich Cat#M9948 3-Indoleacetic acid (IAA) Sigma-Aldrich Cat#15-0330-1 RO-3306 Millipore Cat#217699-5MG Doxycycline Clontech Cat#631311 A/C Heterodimerizer Clontech Cat#635057 Lipofectamine RNAiMAX Invitrogen Cat#13778-030 Opti-MEM GIBCO Cat#31985-062 BSA (Albumin, from Bovine Serum, Fraction V Ph7.0) Wako Cat#013-27054 Triton X-100 Sigma-Aldrich Cat#30-5140-5-500ML-J Goat-serum GIBCO Cat#16210-064 Paraformaldehyde Millipore Cat#104005 Prolong Gold Antifade Reagent Invitrogen Cat#P36930 Cellstain - DAPI solution DOJINDO Cat#D523 cOmplate EDTA-Free Protease Inhibitor Cocktail Roche Cat#5056489001 Benzamidene Sigma-Aldrich Cat#12072-10G ATP Sigma-Aldrich Cat#A2383-1G (Continued on next page) e1 Cell Reports 35, 108999, April 27, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER ADP Sigma-Aldrich Cat#A2754-1G Anti-FLAG antibody beads Sigma-Aldrich Cat#A2220 3x FLAG peptide GL Biochem Cat#056305 Ni-NTA Resin ThermoFisher Cat#88221 Halo Tag Alexa488 Fluor Promega Cat#G1001 OmniPur BSA Sigma-Aldrich Cat#2905-5GM Streptoavidin Sigma-Aldrich Cat#S4762-1MG SYTOX Orange Invitrogen Cat#S11368 Proteinase K Roche Cat#14761400 Topoisomerase I (E.Coli) New England BioLabs Cat#M0301L AcTEV protease Invitrogen Cat#12575-015 Human cohesin FKBP-FRB* (Smc1-FKBP-3HA, Smc3-FRB*3FLAG, Scc1-Halo, 10His-SA1) This paper N/A Human FLAG-Halo NIPBL10His-Mau2 Davidson et al., 2019 N/A FKBP-3HA-EGFP This paper N/A FRB*-3FLAG This paper N/A Critical commercial assays His Trap HP Column GE Healthcare Cat#17-5247-01 SYPRO-Ruby protein gel stain Invitrogen Cat#S12000 ECL prime Western Blotting Detection Reagent GE Healthcare Cat#RPN2232 ECL select Western Blotting Detection Reagent GE Healthcare Cat#RPN2235 Dynabeads Protein G Invitrogen Cat#10003D Click-iT EdU Cell Proliferation Kit for Imaging, Alexa Fluor 647 dye Invitrogen Cat#C10340 Click-iT Plus EdU Cell Proliferation Kit for Imaging, Alexa Fluor 647 dye Invitrogen Cat#C10640 Cellstain - DAPI solution DOJINDO Cat#D523 EnzChek phosphate assay kit Thermo Fisher Scientific Cat#E6646 Deposited data Original data have been depositted to Mendeley Data: http://data.mendeley.com/datasets/9frgkgmb82/ draft?a=51b2c616-ee71-463d-8cf5-34fcccf1cdc6 N/A N/A Experimental models: cell lines HCT116 ATCC CatCCL-247 HCT116 OsTIR1 (AAVS1) Natsume et al., 2016 N/A HCT116 Smc3-FRB*-3FL-Neo This paper N/A HCT116 OsTIR1 (AAVS1) Smc1-FKBP/Smc3-FRB*/Scc1-mAID-mClover This paper N/A Oligonucleotides NIPBL siRNA: CUGAUAAACUAGAACGAAAtt This paper N/A GL2 siRNA: CGUACGCGGAAUACUUCGAtt This paper N/A Sororin siRNA: GCCUAGGUGUCCUUGAGCUtt Nishiyama et al.,2010 N/A Wapl siRNA: CGGACUACCCUUAGCACAAtt Nishiyama et al.,2010 N/A Scc1 siRNA: GGUGAAAAUGGCAUUACGGtt Nishiyama et al.,2010 N/A Recombinant DNA pACEBac1 hCohesin tetramer Smc3-FRB*/Smc1-FKBP (pTN889) This paper pTN889 pGST-FKBP-3HA-EGFP (pTN933) This paper N/A pGST-FRB*-3FLAG (pTN934) This paper N/A pUC57 Smc3-FRB*-3FL-Neo (pTN784) This paper N/A pUC57 hSmc1-FKBP-3HA-BSD (pTN845) This paper N/A pmAID-mClover-Hygro (pTN890) This paper N/A (Continued on next page) Cell Reports 35, 108999, April 27, 2021 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER pX330-hSmc3-C gDNA (pTN779) This paper N/A pX330-hSmc1-C gDNA (pTN844) This paper N/A pX330-hScc1-C gDNA (pTN892) This paper N/A Cas9-AAVS1 T2 CRISPR in px330 Natsume et al., 2016 N/A tet-OsTIR1 (pMK243) Natsume et al., 2016 N/A pFLAG-Halo NIPBL10His-Mau2 Davidson et al., 2019 N/A Software and algorithms Fiji ImageJ open source https://imagej.net/Fiji Prism 8 GraphPad Software https://www.graphpad.com/

    Article Title: TRMT1L-catalyzed m 2 2 G27 on tyrosine tRNA is required for efficient mRNA translation and cell survival under oxidative stress.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-PELP1 Antibody Bethyl Cat#A300-180A; RRID: AB_242526 Rabbit anti-TRMT1L Antibody Bethyl Cat#A305-120A; RRID: AB_2631515 Mouse anti-TRMT1L Antibody Sigma-Aldrich Cat#SAB1408048; RRID: AB_10741695 Rabbit anti-SENP3 Antibody Cell Signaling Technology Cat#5591; RRID: AB_10694546 Rabbit anti-WDR18 Antibody Castle et al.25 N/A Mouse anti-NPM1 Antibody Santa Cruz Biotechnology Cat#sc-56622; RRID: AB_784888 Mouse anti-uL5 (RPL11) Antibody Sigma-Aldrich Cat#SAB1402896; RRID: AB_10738164 Mouse c-Myc Antibody (9E10) Santa Cruz Biotechnology Cat#sc-40; RRID: AB_627268 Rabbit anti-TRMT1 Antibody Bethyl Cat#A304-205A; RRID: AB_2620402 Rabbit anti-Fibrillarin Antibody Bethyl Cat#A303-891A; RRID: AB_2620241 Rabbit anti-DDX21 Antibody Bethyl Cat#A300-627A; RRID: AB_513601 Rabbit anti-N2,N2-dimethylguanosine (m2,2G) Antibody Abcam Cat#ab211488; RRID: AB_3532174 Rabbit IgG Normal Millipore Cat#NI01; RRID: AB_490574 Mouse anti-GAPDH Antibody Santa Cruz Biotechnology Cat#sc-47724; RRID: AB_627678 Mouse anti-puromycin antibody DSHB Cat#PMY-2A4; RRID: AB_2619605 Goat anti-Mouse IgG (H + L) Secondary Antibody, Alexa FluorTM 488 Thermo Fisher Scientific Cat#A-11001; RRID: AB_2534069 Goat anti-Rabbit IgG (H + L) Secondary Antibody, Alexa FluorTM 594 Thermo Fisher Scientific Cat#A-11012; RRID: AB_2534079 Chemicals, peptides, and recombinant proteins Amersham Hybond N+ nylon membrane GE Healthcare RPN303B AMPure RNAClean XP beads Beckman Coulter A63987 AMV Reverse Transcriptase Promega M510A AMV Reverse Transcriptase 5X Reaction Buffer Promega M515A Aprotinin Fisher BP250310 AEBSF Fisher BP635-500 CX-5461 Cellagen Technologies C2954-2s DMEM (no glucose) Gibco 11966025 Exonuclease I NEB M0293S FastAP Thermosensitive Alkaline Phosphatase Thermo Scientific EF0651 Fetal bovine serum Hyclone SV30014.03 High glucose DMEM HyClone SH30022.01 Immun-Star AP substrate Bio-rad 1705018 Lipofectamine RNAi Max Invitrogen 13778150 Murine RNase inhibitor NEB M0314 Penicillin-Streptomycin Hyclone SH40003.01 Protease inhibitor cocktail Thermo Scientific 78437 Protinase K Invitrogen 46–7185 Protein G Dynabeads Invitrogen 10003D Puromycin Sigma P8833 pCp-Biotin Jena Bioscience NU-1706-Bio (Continued on next page) 18 Cell Reports 44, 115167, January 28, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant protein G Sepharose beads Invitrogen 101242 RNase T1 Thermo Scientific EN0541 Streptavidin-alkaline phosophatase conjugate Invitrogen 434322 Streptavidin Magnetic Beads NEB S1420S Streptavidin-IR800 LI-COR 926–32230 SYBR Gold Nucleic Acid Gel Stain Invitrogen S11494 Thapsigargin Sigma 586006 SuperScript IV Reverse Transcriptase Invitrogen 18090010 TRIzol reagent Invitrogen 15596026 Turbo DNase Invitrogen AM2239 TurboDNase buffer Invitrogen AM2238 T4 polynucleotide kinase NEB M0201S T4 polynucleotide kinase reaction buffer NEB B0201S T4 RNA ligase NEB M0204S T4 RNA ligase 2 NEB M0239S Leupeptin Fisher PI78435 [g-32P]ATP Perkin-Elmer NEG502A250UC Nitrocellulose membrane Bio-rad 1620115 anti-DYKDDDDK Magnetic Agarose Pierce A36797 3x DYKDDDDK Peptide Pierce A36805 MAXIscriptTM T7 Transcription Kit Invitrogen AM1312 S-adenosylmethionine (SAM) NEB B9003S Critical commercial assays EconoFit Macro-Prep DEAE columns BioRad 12009274 G50 spin column Cytiva 27533001 Q5 Site-Directed Mutagenesis Kit NEB E0554S Silver stain kit Pierce 24612 BCA assay kit Pierce 23225 Direct RNA Sequencing Kit Oxford Nanopore technologies SQK-RNA002 Monarch RNA Cleanup kit NEB T2030L Zymoclean Gel RNA Recovery Kit Zymo research R1011 Deposited data eCLIP-seq raw and analyzed data This paper GEO: GSE266587 Nano-tRNAseq raw and analyzed data This paper GEO: GSE266588 Proteomic analysis of PELP1 (RIX1) interactome This paper MassIVE: MSV000096583 Experimental models: Cell lines HCT116 ATCC CatCCL-247; RRID: CVCL_0291 HeLa ATCC Cat#CCL-2; RRID: CVCL_0030 HT-1080 ATCC Cat#CCL-121; RRID: CVCL_0317 U2OS ATCC Cat#HTB-96; RRID: CVCL_0042 HEK293T ATCC Cat#CRL-3216; RRID: CVCL_0063 HCT116-WT (non-targeting sgRNA) This study N/A HCT116-TRMT1L KO#1 (TRMT1L sgRNA-1) This study N/A HCT116-TRMT1L KO#2 (TRMT1L sgRNA-2) This study N/A HCT116-WT (non-targeting sgRNA)+Empty This study N/A (Continued on next page) Cell Reports 44, 115167, January 28, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER HCT116-TRMT1L KO#1+Empty This study N/A HCT116-TRMT1L KO#1+TRMT1L WT This study N/A HCT116-TRMT1L KO#1+TRMT1L D373V This study N/A Oligonucleotides See Table S4 for oligonucleotides This study N/A Recombinant DNA pLentiCRISPR v2 Sanjana et al.83 Addgene plasmid #52961; http://n2t.net/ addgene:52961; RRID: Addgene_52961 pCMV-Myc Clontech Cat#631604 pLenti-CMV-GFP-Hygro Campeau et al.84 Addgene plasmid #17446; http://n2t.net/ addgene:17446; RRID: Addgene_17446 p3XFLAG-CMV-7.1 Sigma Cat#E7533 pCMV-Myc-TRMT1L This study N/A pCMV-Myc-TRMT1L mNLS This study N/A pCMV-Myc-TRMT1L mNoLS This study N/A pLenti-CMV-TRMT1L-Hygro This study N/A pLenti-CMV-TRMT1L D373V-Hygro This study N/A pLenti-CMV-Empty-Hygro This study N/A p3xFLAG-CMV-TRMT1L This study N/A p3xFLAG-CMV-TRMT1L D373V This study N/A plentiCRISPR v2-non targeting sgRNA This study N/A plentiCRISPR v2-TRMT1L sgRNA-1 This study N/A plentiCRISPR v2-TRMT1L sgRNA-2 This study N/A Software and algorithms ImageJ Schneider et al.85 https://imagej.net/software/fiji/ Bowtie2 Langmead and Salzberg86 http://bowtie-bio.sourceforge.net/bowtie2/ index.shtml Samtools Li & Li et al.87,88 http://samtools.sourceforge.net/ cNLS Mapper Kosugi et al.29 https://nls-mapper.iab.keio.ac.jp/cgi-bin/ NLS_Mapper_form.cgi NoD tool Scott et al. & Scott et al.27,28 https://www.compbio.dundee.ac.uk/www- nod/ Mongo Oligo Mass Calculator v2.06 Rozenski et al.89 http://rna.rega.kuleuven.be/masspec/ mongo.htm CutAdapt Martin90 https://cutadapt.readthedocs.io/en/stable/ fastp Chen et al.91 https://github.com/OpenGene/fastp PEAKachu peak calling tool Bischler et al.92 https://github.com/tbischler/PEAKachu UMI-tools Smith et al.93 https://github.com/CGATOxford/UMI-tools Burrows-Wheeler Aligner (BWA) Li and Durbin94 https://bio-bwa.sourceforge.net/ BEDTools Quinlan and Hall95 https://github.com/arq5x/bedtools2/ releases Integrative Genomics Viewer (IGV) Thorvaldsdottir et al.96 https://igv.org/doc/desktop/ CHOPCHOP Labun et al.97 https://chopchop.cbu.uib.no/

    Western Blot:

    Article Title: Opening of cohesin's SMC ring is essential for timely DNA replication and DNA loop formation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-Smc3 Bethyl Cat#A300-060A; RRID: AB_67579 Rabbit polyclonal anti-Smc1 Bethyl Cat#A300-055A; RRID: AB_2192467 Rabbit polyclonal anti-Rad21 Bethyl Cat#A300-080A; RRID: AB_2176615 Rabbit polyclonal anti-Wapl Kueng et al., 2006 N/A Rabbit polyclonal anti-Sororin Schmitz et al., 2007 N/A Rabbit polyclonal anti-Pds5A Bethyl Cat#A300-089A; RRID: AB_2162213 Goat polyclonal anti-Histone H3 (C-16) Santa Cruz Cat#Sc8654; RRID: AB_2118303 Mouse monoclonal anti-PCNA (PC10) Santa Cruz Cat#SC56; RRID: AB_628110 Rat monoclonal anti-HA (3F10) Roche Cat#11867423001; RRID: AB_390918 Mouse monoclonal anti-FLAG M2 Sigma-Aldrich Cat#F18041MG; RRID: AB_262044 Chicken polyclonal anti GFP Abcam Cat#ab13970; RRID: AB_300798 Rabbit monoclonal anti-p53 (EP42Y) Abcam Cat#ab239880; RRID: AB_1524137 Rabbit monoclonal anti-Phospho-SMC1 (D7S8Y) CST Cat#58052S; RRID: AB_2799538 Mouse monoclonal anti-Phospho-ATM (Ser1981) CST Cat#4526S; RRID: AB_2062663 Rabbit polyckonal anti-CHK1 (phospho S345) Genetex Cat#GTX100065; RRID: AB_1949975 Mouse monoclonal anti-H2A.X Phospho (Ser139) Biolegend Cat#613401; RRID: AB_315794 Anti-rabbit IgG (HRP-conjugated) GE Healthcare Cat#NA934V; RRID: AB_2722659 Anti-mouse IgG (HRP-conjugated) GE Healthcare Cat#NA931V; RRID: AB_772210 Anti-rat IgG (HRP-conjugated) GE Healthcare Cat#NA935; RRID: AB_772207 Anti-Chicken IgY, Alexa Fluor 488 Invitrogen Cat#A11039; RRID: AB_142924 Anti-Mouse IgG, Alexa Fluor 488 Invitrogen Cat#A21202; RRID: AB_141607 Anti-Rabbit IgG, Alexa Fluor 488 Invitrogen Cat#A11008; RRID: AB_143165 Chemicals, peptides, and recombinant proteins Thymidine Sigma-Aldrich Cat#T1895-5G Nocodazole Sigma-Aldrich Cat#M1404-10MG Aphidicolin Sigma-Aldrich Cat#M1404-10MG Camptothecin Sigma-Aldrich Cat#C9911-100MG Mirin Sigma-Aldrich Cat#M9948 3-Indoleacetic acid (IAA) Sigma-Aldrich Cat#15-0330-1 RO-3306 Millipore Cat#217699-5MG Doxycycline Clontech Cat#631311 A/C Heterodimerizer Clontech Cat#635057 Lipofectamine RNAiMAX Invitrogen Cat#13778-030 Opti-MEM GIBCO Cat#31985-062 BSA (Albumin, from Bovine Serum, Fraction V Ph7.0) Wako Cat#013-27054 Triton X-100 Sigma-Aldrich Cat#30-5140-5-500ML-J Goat-serum GIBCO Cat#16210-064 Paraformaldehyde Millipore Cat#104005 Prolong Gold Antifade Reagent Invitrogen Cat#P36930 Cellstain - DAPI solution DOJINDO Cat#D523 cOmplate EDTA-Free Protease Inhibitor Cocktail Roche Cat#5056489001 Benzamidene Sigma-Aldrich Cat#12072-10G ATP Sigma-Aldrich Cat#A2383-1G (Continued on next page) e1 Cell Reports 35, 108999, April 27, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER ADP Sigma-Aldrich Cat#A2754-1G Anti-FLAG antibody beads Sigma-Aldrich Cat#A2220 3x FLAG peptide GL Biochem Cat#056305 Ni-NTA Resin ThermoFisher Cat#88221 Halo Tag Alexa488 Fluor Promega Cat#G1001 OmniPur BSA Sigma-Aldrich Cat#2905-5GM Streptoavidin Sigma-Aldrich Cat#S4762-1MG SYTOX Orange Invitrogen Cat#S11368 Proteinase K Roche Cat#14761400 Topoisomerase I (E.Coli) New England BioLabs Cat#M0301L AcTEV protease Invitrogen Cat#12575-015 Human cohesin FKBP-FRB* (Smc1-FKBP-3HA, Smc3-FRB*3FLAG, Scc1-Halo, 10His-SA1) This paper N/A Human FLAG-Halo NIPBL10His-Mau2 Davidson et al., 2019 N/A FKBP-3HA-EGFP This paper N/A FRB*-3FLAG This paper N/A Critical commercial assays His Trap HP Column GE Healthcare Cat#17-5247-01 SYPRO-Ruby protein gel stain Invitrogen Cat#S12000 ECL prime Western Blotting Detection Reagent GE Healthcare Cat#RPN2232 ECL select Western Blotting Detection Reagent GE Healthcare Cat#RPN2235 Dynabeads Protein G Invitrogen Cat#10003D Click-iT EdU Cell Proliferation Kit for Imaging, Alexa Fluor 647 dye Invitrogen Cat#C10340 Click-iT Plus EdU Cell Proliferation Kit for Imaging, Alexa Fluor 647 dye Invitrogen Cat#C10640 Cellstain - DAPI solution DOJINDO Cat#D523 EnzChek phosphate assay kit Thermo Fisher Scientific Cat#E6646 Deposited data Original data have been depositted to Mendeley Data: http://data.mendeley.com/datasets/9frgkgmb82/ draft?a=51b2c616-ee71-463d-8cf5-34fcccf1cdc6 N/A N/A Experimental models: cell lines HCT116 ATCC CatCCL-247 HCT116 OsTIR1 (AAVS1) Natsume et al., 2016 N/A HCT116 Smc3-FRB*-3FL-Neo This paper N/A HCT116 OsTIR1 (AAVS1) Smc1-FKBP/Smc3-FRB*/Scc1-mAID-mClover This paper N/A Oligonucleotides NIPBL siRNA: CUGAUAAACUAGAACGAAAtt This paper N/A GL2 siRNA: CGUACGCGGAAUACUUCGAtt This paper N/A Sororin siRNA: GCCUAGGUGUCCUUGAGCUtt Nishiyama et al.,2010 N/A Wapl siRNA: CGGACUACCCUUAGCACAAtt Nishiyama et al.,2010 N/A Scc1 siRNA: GGUGAAAAUGGCAUUACGGtt Nishiyama et al.,2010 N/A Recombinant DNA pACEBac1 hCohesin tetramer Smc3-FRB*/Smc1-FKBP (pTN889) This paper pTN889 pGST-FKBP-3HA-EGFP (pTN933) This paper N/A pGST-FRB*-3FLAG (pTN934) This paper N/A pUC57 Smc3-FRB*-3FL-Neo (pTN784) This paper N/A pUC57 hSmc1-FKBP-3HA-BSD (pTN845) This paper N/A pmAID-mClover-Hygro (pTN890) This paper N/A (Continued on next page) Cell Reports 35, 108999, April 27, 2021 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER pX330-hSmc3-C gDNA (pTN779) This paper N/A pX330-hSmc1-C gDNA (pTN844) This paper N/A pX330-hScc1-C gDNA (pTN892) This paper N/A Cas9-AAVS1 T2 CRISPR in px330 Natsume et al., 2016 N/A tet-OsTIR1 (pMK243) Natsume et al., 2016 N/A pFLAG-Halo NIPBL10His-Mau2 Davidson et al., 2019 N/A Software and algorithms Fiji ImageJ open source https://imagej.net/Fiji Prism 8 GraphPad Software https://www.graphpad.com/

    Imaging:

    Article Title: Opening of cohesin's SMC ring is essential for timely DNA replication and DNA loop formation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-Smc3 Bethyl Cat#A300-060A; RRID: AB_67579 Rabbit polyclonal anti-Smc1 Bethyl Cat#A300-055A; RRID: AB_2192467 Rabbit polyclonal anti-Rad21 Bethyl Cat#A300-080A; RRID: AB_2176615 Rabbit polyclonal anti-Wapl Kueng et al., 2006 N/A Rabbit polyclonal anti-Sororin Schmitz et al., 2007 N/A Rabbit polyclonal anti-Pds5A Bethyl Cat#A300-089A; RRID: AB_2162213 Goat polyclonal anti-Histone H3 (C-16) Santa Cruz Cat#Sc8654; RRID: AB_2118303 Mouse monoclonal anti-PCNA (PC10) Santa Cruz Cat#SC56; RRID: AB_628110 Rat monoclonal anti-HA (3F10) Roche Cat#11867423001; RRID: AB_390918 Mouse monoclonal anti-FLAG M2 Sigma-Aldrich Cat#F18041MG; RRID: AB_262044 Chicken polyclonal anti GFP Abcam Cat#ab13970; RRID: AB_300798 Rabbit monoclonal anti-p53 (EP42Y) Abcam Cat#ab239880; RRID: AB_1524137 Rabbit monoclonal anti-Phospho-SMC1 (D7S8Y) CST Cat#58052S; RRID: AB_2799538 Mouse monoclonal anti-Phospho-ATM (Ser1981) CST Cat#4526S; RRID: AB_2062663 Rabbit polyckonal anti-CHK1 (phospho S345) Genetex Cat#GTX100065; RRID: AB_1949975 Mouse monoclonal anti-H2A.X Phospho (Ser139) Biolegend Cat#613401; RRID: AB_315794 Anti-rabbit IgG (HRP-conjugated) GE Healthcare Cat#NA934V; RRID: AB_2722659 Anti-mouse IgG (HRP-conjugated) GE Healthcare Cat#NA931V; RRID: AB_772210 Anti-rat IgG (HRP-conjugated) GE Healthcare Cat#NA935; RRID: AB_772207 Anti-Chicken IgY, Alexa Fluor 488 Invitrogen Cat#A11039; RRID: AB_142924 Anti-Mouse IgG, Alexa Fluor 488 Invitrogen Cat#A21202; RRID: AB_141607 Anti-Rabbit IgG, Alexa Fluor 488 Invitrogen Cat#A11008; RRID: AB_143165 Chemicals, peptides, and recombinant proteins Thymidine Sigma-Aldrich Cat#T1895-5G Nocodazole Sigma-Aldrich Cat#M1404-10MG Aphidicolin Sigma-Aldrich Cat#M1404-10MG Camptothecin Sigma-Aldrich Cat#C9911-100MG Mirin Sigma-Aldrich Cat#M9948 3-Indoleacetic acid (IAA) Sigma-Aldrich Cat#15-0330-1 RO-3306 Millipore Cat#217699-5MG Doxycycline Clontech Cat#631311 A/C Heterodimerizer Clontech Cat#635057 Lipofectamine RNAiMAX Invitrogen Cat#13778-030 Opti-MEM GIBCO Cat#31985-062 BSA (Albumin, from Bovine Serum, Fraction V Ph7.0) Wako Cat#013-27054 Triton X-100 Sigma-Aldrich Cat#30-5140-5-500ML-J Goat-serum GIBCO Cat#16210-064 Paraformaldehyde Millipore Cat#104005 Prolong Gold Antifade Reagent Invitrogen Cat#P36930 Cellstain - DAPI solution DOJINDO Cat#D523 cOmplate EDTA-Free Protease Inhibitor Cocktail Roche Cat#5056489001 Benzamidene Sigma-Aldrich Cat#12072-10G ATP Sigma-Aldrich Cat#A2383-1G (Continued on next page) e1 Cell Reports 35, 108999, April 27, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER ADP Sigma-Aldrich Cat#A2754-1G Anti-FLAG antibody beads Sigma-Aldrich Cat#A2220 3x FLAG peptide GL Biochem Cat#056305 Ni-NTA Resin ThermoFisher Cat#88221 Halo Tag Alexa488 Fluor Promega Cat#G1001 OmniPur BSA Sigma-Aldrich Cat#2905-5GM Streptoavidin Sigma-Aldrich Cat#S4762-1MG SYTOX Orange Invitrogen Cat#S11368 Proteinase K Roche Cat#14761400 Topoisomerase I (E.Coli) New England BioLabs Cat#M0301L AcTEV protease Invitrogen Cat#12575-015 Human cohesin FKBP-FRB* (Smc1-FKBP-3HA, Smc3-FRB*3FLAG, Scc1-Halo, 10His-SA1) This paper N/A Human FLAG-Halo NIPBL10His-Mau2 Davidson et al., 2019 N/A FKBP-3HA-EGFP This paper N/A FRB*-3FLAG This paper N/A Critical commercial assays His Trap HP Column GE Healthcare Cat#17-5247-01 SYPRO-Ruby protein gel stain Invitrogen Cat#S12000 ECL prime Western Blotting Detection Reagent GE Healthcare Cat#RPN2232 ECL select Western Blotting Detection Reagent GE Healthcare Cat#RPN2235 Dynabeads Protein G Invitrogen Cat#10003D Click-iT EdU Cell Proliferation Kit for Imaging, Alexa Fluor 647 dye Invitrogen Cat#C10340 Click-iT Plus EdU Cell Proliferation Kit for Imaging, Alexa Fluor 647 dye Invitrogen Cat#C10640 Cellstain - DAPI solution DOJINDO Cat#D523 EnzChek phosphate assay kit Thermo Fisher Scientific Cat#E6646 Deposited data Original data have been depositted to Mendeley Data: http://data.mendeley.com/datasets/9frgkgmb82/ draft?a=51b2c616-ee71-463d-8cf5-34fcccf1cdc6 N/A N/A Experimental models: cell lines HCT116 ATCC CatCCL-247 HCT116 OsTIR1 (AAVS1) Natsume et al., 2016 N/A HCT116 Smc3-FRB*-3FL-Neo This paper N/A HCT116 OsTIR1 (AAVS1) Smc1-FKBP/Smc3-FRB*/Scc1-mAID-mClover This paper N/A Oligonucleotides NIPBL siRNA: CUGAUAAACUAGAACGAAAtt This paper N/A GL2 siRNA: CGUACGCGGAAUACUUCGAtt This paper N/A Sororin siRNA: GCCUAGGUGUCCUUGAGCUtt Nishiyama et al.,2010 N/A Wapl siRNA: CGGACUACCCUUAGCACAAtt Nishiyama et al.,2010 N/A Scc1 siRNA: GGUGAAAAUGGCAUUACGGtt Nishiyama et al.,2010 N/A Recombinant DNA pACEBac1 hCohesin tetramer Smc3-FRB*/Smc1-FKBP (pTN889) This paper pTN889 pGST-FKBP-3HA-EGFP (pTN933) This paper N/A pGST-FRB*-3FLAG (pTN934) This paper N/A pUC57 Smc3-FRB*-3FL-Neo (pTN784) This paper N/A pUC57 hSmc1-FKBP-3HA-BSD (pTN845) This paper N/A pmAID-mClover-Hygro (pTN890) This paper N/A (Continued on next page) Cell Reports 35, 108999, April 27, 2021 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER pX330-hSmc3-C gDNA (pTN779) This paper N/A pX330-hSmc1-C gDNA (pTN844) This paper N/A pX330-hScc1-C gDNA (pTN892) This paper N/A Cas9-AAVS1 T2 CRISPR in px330 Natsume et al., 2016 N/A tet-OsTIR1 (pMK243) Natsume et al., 2016 N/A pFLAG-Halo NIPBL10His-Mau2 Davidson et al., 2019 N/A Software and algorithms Fiji ImageJ open source https://imagej.net/Fiji Prism 8 GraphPad Software https://www.graphpad.com/

    Recombinant:

    Article Title: Opening of cohesin's SMC ring is essential for timely DNA replication and DNA loop formation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-Smc3 Bethyl Cat#A300-060A; RRID: AB_67579 Rabbit polyclonal anti-Smc1 Bethyl Cat#A300-055A; RRID: AB_2192467 Rabbit polyclonal anti-Rad21 Bethyl Cat#A300-080A; RRID: AB_2176615 Rabbit polyclonal anti-Wapl Kueng et al., 2006 N/A Rabbit polyclonal anti-Sororin Schmitz et al., 2007 N/A Rabbit polyclonal anti-Pds5A Bethyl Cat#A300-089A; RRID: AB_2162213 Goat polyclonal anti-Histone H3 (C-16) Santa Cruz Cat#Sc8654; RRID: AB_2118303 Mouse monoclonal anti-PCNA (PC10) Santa Cruz Cat#SC56; RRID: AB_628110 Rat monoclonal anti-HA (3F10) Roche Cat#11867423001; RRID: AB_390918 Mouse monoclonal anti-FLAG M2 Sigma-Aldrich Cat#F18041MG; RRID: AB_262044 Chicken polyclonal anti GFP Abcam Cat#ab13970; RRID: AB_300798 Rabbit monoclonal anti-p53 (EP42Y) Abcam Cat#ab239880; RRID: AB_1524137 Rabbit monoclonal anti-Phospho-SMC1 (D7S8Y) CST Cat#58052S; RRID: AB_2799538 Mouse monoclonal anti-Phospho-ATM (Ser1981) CST Cat#4526S; RRID: AB_2062663 Rabbit polyckonal anti-CHK1 (phospho S345) Genetex Cat#GTX100065; RRID: AB_1949975 Mouse monoclonal anti-H2A.X Phospho (Ser139) Biolegend Cat#613401; RRID: AB_315794 Anti-rabbit IgG (HRP-conjugated) GE Healthcare Cat#NA934V; RRID: AB_2722659 Anti-mouse IgG (HRP-conjugated) GE Healthcare Cat#NA931V; RRID: AB_772210 Anti-rat IgG (HRP-conjugated) GE Healthcare Cat#NA935; RRID: AB_772207 Anti-Chicken IgY, Alexa Fluor 488 Invitrogen Cat#A11039; RRID: AB_142924 Anti-Mouse IgG, Alexa Fluor 488 Invitrogen Cat#A21202; RRID: AB_141607 Anti-Rabbit IgG, Alexa Fluor 488 Invitrogen Cat#A11008; RRID: AB_143165 Chemicals, peptides, and recombinant proteins Thymidine Sigma-Aldrich Cat#T1895-5G Nocodazole Sigma-Aldrich Cat#M1404-10MG Aphidicolin Sigma-Aldrich Cat#M1404-10MG Camptothecin Sigma-Aldrich Cat#C9911-100MG Mirin Sigma-Aldrich Cat#M9948 3-Indoleacetic acid (IAA) Sigma-Aldrich Cat#15-0330-1 RO-3306 Millipore Cat#217699-5MG Doxycycline Clontech Cat#631311 A/C Heterodimerizer Clontech Cat#635057 Lipofectamine RNAiMAX Invitrogen Cat#13778-030 Opti-MEM GIBCO Cat#31985-062 BSA (Albumin, from Bovine Serum, Fraction V Ph7.0) Wako Cat#013-27054 Triton X-100 Sigma-Aldrich Cat#30-5140-5-500ML-J Goat-serum GIBCO Cat#16210-064 Paraformaldehyde Millipore Cat#104005 Prolong Gold Antifade Reagent Invitrogen Cat#P36930 Cellstain - DAPI solution DOJINDO Cat#D523 cOmplate EDTA-Free Protease Inhibitor Cocktail Roche Cat#5056489001 Benzamidene Sigma-Aldrich Cat#12072-10G ATP Sigma-Aldrich Cat#A2383-1G (Continued on next page) e1 Cell Reports 35, 108999, April 27, 2021 .. REAGENT or RESOURCE SOURCE IDENTIFIER ADP Sigma-Aldrich Cat#A2754-1G Anti-FLAG antibody beads Sigma-Aldrich Cat#A2220 3x FLAG peptide GL Biochem Cat#056305 Ni-NTA Resin ThermoFisher Cat#88221 Halo Tag Alexa488 Fluor Promega Cat#G1001 OmniPur BSA Sigma-Aldrich Cat#2905-5GM Streptoavidin Sigma-Aldrich Cat#S4762-1MG SYTOX Orange Invitrogen Cat#S11368 Proteinase K Roche Cat#14761400 Topoisomerase I (E.Coli) New England BioLabs Cat#M0301L AcTEV protease Invitrogen Cat#12575-015 Human cohesin FKBP-FRB* (Smc1-FKBP-3HA, Smc3-FRB*3FLAG, Scc1-Halo, 10His-SA1) This paper N/A Human FLAG-Halo NIPBL10His-Mau2 Davidson et al., 2019 N/A FKBP-3HA-EGFP This paper N/A FRB*-3FLAG This paper N/A Critical commercial assays His Trap HP Column GE Healthcare Cat#17-5247-01 SYPRO-Ruby protein gel stain Invitrogen Cat#S12000 ECL prime Western Blotting Detection Reagent GE Healthcare Cat#RPN2232 ECL select Western Blotting Detection Reagent GE Healthcare Cat#RPN2235 Dynabeads Protein G Invitrogen Cat#10003D Click-iT EdU Cell Proliferation Kit for Imaging, Alexa Fluor 647 dye Invitrogen Cat#C10340 Click-iT Plus EdU Cell Proliferation Kit for Imaging, Alexa Fluor 647 dye Invitrogen Cat#C10640 Cellstain - DAPI solution DOJINDO Cat#D523 EnzChek phosphate assay kit Thermo Fisher Scientific Cat#E6646 Deposited data Original data have been depositted to Mendeley Data: http://data.mendeley.com/datasets/9frgkgmb82/ draft?a=51b2c616-ee71-463d-8cf5-34fcccf1cdc6 N/A N/A Experimental models: cell lines HCT116 ATCC CatCCL-247 HCT116 OsTIR1 (AAVS1) Natsume et al., 2016 N/A HCT116 Smc3-FRB*-3FL-Neo This paper N/A HCT116 OsTIR1 (AAVS1) Smc1-FKBP/Smc3-FRB*/Scc1-mAID-mClover This paper N/A Oligonucleotides NIPBL siRNA: CUGAUAAACUAGAACGAAAtt This paper N/A GL2 siRNA: CGUACGCGGAAUACUUCGAtt This paper N/A Sororin siRNA: GCCUAGGUGUCCUUGAGCUtt Nishiyama et al.,2010 N/A Wapl siRNA: CGGACUACCCUUAGCACAAtt Nishiyama et al.,2010 N/A Scc1 siRNA: GGUGAAAAUGGCAUUACGGtt Nishiyama et al.,2010 N/A Recombinant DNA pACEBac1 hCohesin tetramer Smc3-FRB*/Smc1-FKBP (pTN889) This paper pTN889 pGST-FKBP-3HA-EGFP (pTN933) This paper N/A pGST-FRB*-3FLAG (pTN934) This paper N/A pUC57 Smc3-FRB*-3FL-Neo (pTN784) This paper N/A pUC57 hSmc1-FKBP-3HA-BSD (pTN845) This paper N/A pmAID-mClover-Hygro (pTN890) This paper N/A (Continued on next page) Cell Reports 35, 108999, April 27, 2021 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER pX330-hSmc3-C gDNA (pTN779) This paper N/A pX330-hSmc1-C gDNA (pTN844) This paper N/A pX330-hScc1-C gDNA (pTN892) This paper N/A Cas9-AAVS1 T2 CRISPR in px330 Natsume et al., 2016 N/A tet-OsTIR1 (pMK243) Natsume et al., 2016 N/A pFLAG-Halo NIPBL10His-Mau2 Davidson et al., 2019 N/A Software and algorithms Fiji ImageJ open source https://imagej.net/Fiji Prism 8 GraphPad Software https://www.graphpad.com/

    Article Title: Impact of supraphysiologic MDM2 expression on chromatin networks and therapeutic responses in sarcoma
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Actin Bio-Rad Cat#12004163, RRID:AB_2861334 H3K27ac Active Motif Cat#39133, RRID:AB_2561016 JUN Cell Signaling Cat#9165S, RRID:AB_2130165 MDM2 Abcam Cat#ab226939, RRID:AB_2754988 P53 Cell Signaling Cat#48818, RRID:AB_2713958 PML Santa Cruz Cat#sc-966, RRID:AB_628162 RUNX2 Cell Signaling Cat#12556S, RRID:AB_2732805 YY1 Santa Cruz Cat#sc-7341, RRID:AB_2257497 Drosophila spike-in chromatin antibody Active Motif Cat#61686, RRID:AB_2737370 Biological samples See Table S1 for a list of patient samples included in the study N/A Chemicals, peptides, and recombinant proteins HDM201 SelleckChem Cat#S8606 Nutlin-3a SelleckChem Cat#S8059 Navitoclax SelleckChem Cat#S1001 Klenow Fragment (3-5exo-) NEB Cat#M0212L Drosophila spike-in chromatin Active Motif Cat#53083 MboI NEB Cat# R0147M Biotin-dATP ThermoFisher Cat#195224016 Streptavidin M280 beads Invitrogen Cat#11205D RIPA buffer Life Technologies Cat#89900 HALT protease phosphatase inhibitor cocktail ThermoFisher Cat#78440 Cell Titer-Glo Promega Cat#G7570 16% Formaldehyde Life Technologies Cat#28908 Vectashield Vector labs Cat#H-1000-10 Fluoromount G Invitrogen Cat#00495802 KaryoMAX colcemid solution Life Technologies Cat#15212012 DAPI (40,6-Diamidino-2-Phenylindole, Dihydrochloride) Thermo Fisher Cat#D1306 Critical commercial assays QIAGEN RNeasy lipid kit Qiagen Cat#74804 End-It DNA repair kit Biosearch Technologies Cat#ER0720 KAPA HiFi HotStart ReadyMix PCR Kit Roche Cat#07958935001 Zymo Clean and Concentrate Kit Zymo Cat#DCC-100 Nextera DNA library prep kit Illumina Cat#20018704 BCA protein assay kit ThermoFisher Cat#23227 Dead cell apoptosis kit Invitrogen Cat#V13241 Deposited data Sequencing data This paper GEO: GSE213300 Human transcriptomic data derived from the TCGA Xena curated data repository https://pancanatlas.xenahubs.net H3K27ac HiChIP of normal tissues Mumbach et al.20 GEO: GSE101498 (Continued on next page) Cell Genomics 3, 100321, July 12, 2023 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines HCT116 ATCC CatCCL-247, RRID:CVCL_0291 U-2 OS ATCC Cat#HTB-96, RRID:CVCL_0042 LPS141 gift from Dr. Adrian Marino-Enriquez Brigham and Women’s Hospital LPS853 gift from Dr. Adrian Marino-Enriquez Brigham and Women’s Hospital 93T449 gift from Dr. Adrian Marino-Enriquez Brigham and Women’s Hospital 94T778 gift from Dr. Adrian Marino-Enriquez Brigham and Women’s Hospital Oligonucleotides Safe harbor sgRNA IDT GGCTAAATTCCTCTTATTCA TP53 sgRNA IDT TCGACGCTAGGATCTGACTG PCR of P53 CRISPR targeting region -Forward primer IDT CCCAACCCTTGTCCTTACCA PCR of P53 CRISPR targeting region -Reverse primer IDT CAACATGCAAAGCCCTGTCT Chr12 FISH probes Empire Genomics Cat#CHR12-10-GR MDM2 FISH probes Empire Genomics Cat#MDM2-20-OR Recombinant DNA pXPR_044, all in one CRISPR-Cas9 vector gift from John Doench and Dave Root Broad Institute, Genomics Perturbation Plat-form Software and algorithms Code supporting this study This paper https://github.com/BernsteinLab/ methods_mdm2_sarcoma; https://doi.org/10.5281/zenodo.7814766 STAR Dobin et al.78 version 2.7.10 Juicebox Durand et al.79 http://aidenlab.org/juicebox/ Hichipper Lareau et al.80 version 0.7.9 HiC-Pro Servant et al.81 version 2.10.0 Bioconductor Huber et al.582 Release 3.13 Homer Heinz et al.83 version 4.11 Samtools Danecek et al.84 version 1.15.1 Bedtools Quinlan et al.85 version 2.29.0 HTSlib Bonfield et al.86 version 1.15.1 FIJI Schindelin et al.87 version 2.0.0-rc-43/1.5h CellProfiler Stirling et al.88 version 4.2.1 SynergyFinder Ianevski et al.89 version 1.6.1 FlowJo BD biosciences version 10.8.0 Article ll OPEN ACCESS ..

    Article Title: TRMT1L-catalyzed m 2 2 G27 on tyrosine tRNA is required for efficient mRNA translation and cell survival under oxidative stress.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-PELP1 Antibody Bethyl Cat#A300-180A; RRID: AB_242526 Rabbit anti-TRMT1L Antibody Bethyl Cat#A305-120A; RRID: AB_2631515 Mouse anti-TRMT1L Antibody Sigma-Aldrich Cat#SAB1408048; RRID: AB_10741695 Rabbit anti-SENP3 Antibody Cell Signaling Technology Cat#5591; RRID: AB_10694546 Rabbit anti-WDR18 Antibody Castle et al.25 N/A Mouse anti-NPM1 Antibody Santa Cruz Biotechnology Cat#sc-56622; RRID: AB_784888 Mouse anti-uL5 (RPL11) Antibody Sigma-Aldrich Cat#SAB1402896; RRID: AB_10738164 Mouse c-Myc Antibody (9E10) Santa Cruz Biotechnology Cat#sc-40; RRID: AB_627268 Rabbit anti-TRMT1 Antibody Bethyl Cat#A304-205A; RRID: AB_2620402 Rabbit anti-Fibrillarin Antibody Bethyl Cat#A303-891A; RRID: AB_2620241 Rabbit anti-DDX21 Antibody Bethyl Cat#A300-627A; RRID: AB_513601 Rabbit anti-N2,N2-dimethylguanosine (m2,2G) Antibody Abcam Cat#ab211488; RRID: AB_3532174 Rabbit IgG Normal Millipore Cat#NI01; RRID: AB_490574 Mouse anti-GAPDH Antibody Santa Cruz Biotechnology Cat#sc-47724; RRID: AB_627678 Mouse anti-puromycin antibody DSHB Cat#PMY-2A4; RRID: AB_2619605 Goat anti-Mouse IgG (H + L) Secondary Antibody, Alexa FluorTM 488 Thermo Fisher Scientific Cat#A-11001; RRID: AB_2534069 Goat anti-Rabbit IgG (H + L) Secondary Antibody, Alexa FluorTM 594 Thermo Fisher Scientific Cat#A-11012; RRID: AB_2534079 Chemicals, peptides, and recombinant proteins Amersham Hybond N+ nylon membrane GE Healthcare RPN303B AMPure RNAClean XP beads Beckman Coulter A63987 AMV Reverse Transcriptase Promega M510A AMV Reverse Transcriptase 5X Reaction Buffer Promega M515A Aprotinin Fisher BP250310 AEBSF Fisher BP635-500 CX-5461 Cellagen Technologies C2954-2s DMEM (no glucose) Gibco 11966025 Exonuclease I NEB M0293S FastAP Thermosensitive Alkaline Phosphatase Thermo Scientific EF0651 Fetal bovine serum Hyclone SV30014.03 High glucose DMEM HyClone SH30022.01 Immun-Star AP substrate Bio-rad 1705018 Lipofectamine RNAi Max Invitrogen 13778150 Murine RNase inhibitor NEB M0314 Penicillin-Streptomycin Hyclone SH40003.01 Protease inhibitor cocktail Thermo Scientific 78437 Protinase K Invitrogen 46–7185 Protein G Dynabeads Invitrogen 10003D Puromycin Sigma P8833 pCp-Biotin Jena Bioscience NU-1706-Bio (Continued on next page) 18 Cell Reports 44, 115167, January 28, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant protein G Sepharose beads Invitrogen 101242 RNase T1 Thermo Scientific EN0541 Streptavidin-alkaline phosophatase conjugate Invitrogen 434322 Streptavidin Magnetic Beads NEB S1420S Streptavidin-IR800 LI-COR 926–32230 SYBR Gold Nucleic Acid Gel Stain Invitrogen S11494 Thapsigargin Sigma 586006 SuperScript IV Reverse Transcriptase Invitrogen 18090010 TRIzol reagent Invitrogen 15596026 Turbo DNase Invitrogen AM2239 TurboDNase buffer Invitrogen AM2238 T4 polynucleotide kinase NEB M0201S T4 polynucleotide kinase reaction buffer NEB B0201S T4 RNA ligase NEB M0204S T4 RNA ligase 2 NEB M0239S Leupeptin Fisher PI78435 [g-32P]ATP Perkin-Elmer NEG502A250UC Nitrocellulose membrane Bio-rad 1620115 anti-DYKDDDDK Magnetic Agarose Pierce A36797 3x DYKDDDDK Peptide Pierce A36805 MAXIscriptTM T7 Transcription Kit Invitrogen AM1312 S-adenosylmethionine (SAM) NEB B9003S Critical commercial assays EconoFit Macro-Prep DEAE columns BioRad 12009274 G50 spin column Cytiva 27533001 Q5 Site-Directed Mutagenesis Kit NEB E0554S Silver stain kit Pierce 24612 BCA assay kit Pierce 23225 Direct RNA Sequencing Kit Oxford Nanopore technologies SQK-RNA002 Monarch RNA Cleanup kit NEB T2030L Zymoclean Gel RNA Recovery Kit Zymo research R1011 Deposited data eCLIP-seq raw and analyzed data This paper GEO: GSE266587 Nano-tRNAseq raw and analyzed data This paper GEO: GSE266588 Proteomic analysis of PELP1 (RIX1) interactome This paper MassIVE: MSV000096583 Experimental models: Cell lines HCT116 ATCC CatCCL-247; RRID: CVCL_0291 HeLa ATCC Cat#CCL-2; RRID: CVCL_0030 HT-1080 ATCC Cat#CCL-121; RRID: CVCL_0317 U2OS ATCC Cat#HTB-96; RRID: CVCL_0042 HEK293T ATCC Cat#CRL-3216; RRID: CVCL_0063 HCT116-WT (non-targeting sgRNA) This study N/A HCT116-TRMT1L KO#1 (TRMT1L sgRNA-1) This study N/A HCT116-TRMT1L KO#2 (TRMT1L sgRNA-2) This study N/A HCT116-WT (non-targeting sgRNA)+Empty This study N/A (Continued on next page) Cell Reports 44, 115167, January 28, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER HCT116-TRMT1L KO#1+Empty This study N/A HCT116-TRMT1L KO#1+TRMT1L WT This study N/A HCT116-TRMT1L KO#1+TRMT1L D373V This study N/A Oligonucleotides See Table S4 for oligonucleotides This study N/A Recombinant DNA pLentiCRISPR v2 Sanjana et al.83 Addgene plasmid #52961; http://n2t.net/ addgene:52961; RRID: Addgene_52961 pCMV-Myc Clontech Cat#631604 pLenti-CMV-GFP-Hygro Campeau et al.84 Addgene plasmid #17446; http://n2t.net/ addgene:17446; RRID: Addgene_17446 p3XFLAG-CMV-7.1 Sigma Cat#E7533 pCMV-Myc-TRMT1L This study N/A pCMV-Myc-TRMT1L mNLS This study N/A pCMV-Myc-TRMT1L mNoLS This study N/A pLenti-CMV-TRMT1L-Hygro This study N/A pLenti-CMV-TRMT1L D373V-Hygro This study N/A pLenti-CMV-Empty-Hygro This study N/A p3xFLAG-CMV-TRMT1L This study N/A p3xFLAG-CMV-TRMT1L D373V This study N/A plentiCRISPR v2-non targeting sgRNA This study N/A plentiCRISPR v2-TRMT1L sgRNA-1 This study N/A plentiCRISPR v2-TRMT1L sgRNA-2 This study N/A Software and algorithms ImageJ Schneider et al.85 https://imagej.net/software/fiji/ Bowtie2 Langmead and Salzberg86 http://bowtie-bio.sourceforge.net/bowtie2/ index.shtml Samtools Li & Li et al.87,88 http://samtools.sourceforge.net/ cNLS Mapper Kosugi et al.29 https://nls-mapper.iab.keio.ac.jp/cgi-bin/ NLS_Mapper_form.cgi NoD tool Scott et al. & Scott et al.27,28 https://www.compbio.dundee.ac.uk/www- nod/ Mongo Oligo Mass Calculator v2.06 Rozenski et al.89 http://rna.rega.kuleuven.be/masspec/ mongo.htm CutAdapt Martin90 https://cutadapt.readthedocs.io/en/stable/ fastp Chen et al.91 https://github.com/OpenGene/fastp PEAKachu peak calling tool Bischler et al.92 https://github.com/tbischler/PEAKachu UMI-tools Smith et al.93 https://github.com/CGATOxford/UMI-tools Burrows-Wheeler Aligner (BWA) Li and Durbin94 https://bio-bwa.sourceforge.net/ BEDTools Quinlan and Hall95 https://github.com/arq5x/bedtools2/ releases Integrative Genomics Viewer (IGV) Thorvaldsdottir et al.96 https://igv.org/doc/desktop/ CHOPCHOP Labun et al.97 https://chopchop.cbu.uib.no/

    Polymerase Chain Reaction:

    Article Title: Impact of supraphysiologic MDM2 expression on chromatin networks and therapeutic responses in sarcoma
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Actin Bio-Rad Cat#12004163, RRID:AB_2861334 H3K27ac Active Motif Cat#39133, RRID:AB_2561016 JUN Cell Signaling Cat#9165S, RRID:AB_2130165 MDM2 Abcam Cat#ab226939, RRID:AB_2754988 P53 Cell Signaling Cat#48818, RRID:AB_2713958 PML Santa Cruz Cat#sc-966, RRID:AB_628162 RUNX2 Cell Signaling Cat#12556S, RRID:AB_2732805 YY1 Santa Cruz Cat#sc-7341, RRID:AB_2257497 Drosophila spike-in chromatin antibody Active Motif Cat#61686, RRID:AB_2737370 Biological samples See Table S1 for a list of patient samples included in the study N/A Chemicals, peptides, and recombinant proteins HDM201 SelleckChem Cat#S8606 Nutlin-3a SelleckChem Cat#S8059 Navitoclax SelleckChem Cat#S1001 Klenow Fragment (3-5exo-) NEB Cat#M0212L Drosophila spike-in chromatin Active Motif Cat#53083 MboI NEB Cat# R0147M Biotin-dATP ThermoFisher Cat#195224016 Streptavidin M280 beads Invitrogen Cat#11205D RIPA buffer Life Technologies Cat#89900 HALT protease phosphatase inhibitor cocktail ThermoFisher Cat#78440 Cell Titer-Glo Promega Cat#G7570 16% Formaldehyde Life Technologies Cat#28908 Vectashield Vector labs Cat#H-1000-10 Fluoromount G Invitrogen Cat#00495802 KaryoMAX colcemid solution Life Technologies Cat#15212012 DAPI (40,6-Diamidino-2-Phenylindole, Dihydrochloride) Thermo Fisher Cat#D1306 Critical commercial assays QIAGEN RNeasy lipid kit Qiagen Cat#74804 End-It DNA repair kit Biosearch Technologies Cat#ER0720 KAPA HiFi HotStart ReadyMix PCR Kit Roche Cat#07958935001 Zymo Clean and Concentrate Kit Zymo Cat#DCC-100 Nextera DNA library prep kit Illumina Cat#20018704 BCA protein assay kit ThermoFisher Cat#23227 Dead cell apoptosis kit Invitrogen Cat#V13241 Deposited data Sequencing data This paper GEO: GSE213300 Human transcriptomic data derived from the TCGA Xena curated data repository https://pancanatlas.xenahubs.net H3K27ac HiChIP of normal tissues Mumbach et al.20 GEO: GSE101498 (Continued on next page) Cell Genomics 3, 100321, July 12, 2023 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines HCT116 ATCC CatCCL-247, RRID:CVCL_0291 U-2 OS ATCC Cat#HTB-96, RRID:CVCL_0042 LPS141 gift from Dr. Adrian Marino-Enriquez Brigham and Women’s Hospital LPS853 gift from Dr. Adrian Marino-Enriquez Brigham and Women’s Hospital 93T449 gift from Dr. Adrian Marino-Enriquez Brigham and Women’s Hospital 94T778 gift from Dr. Adrian Marino-Enriquez Brigham and Women’s Hospital Oligonucleotides Safe harbor sgRNA IDT GGCTAAATTCCTCTTATTCA TP53 sgRNA IDT TCGACGCTAGGATCTGACTG PCR of P53 CRISPR targeting region -Forward primer IDT CCCAACCCTTGTCCTTACCA PCR of P53 CRISPR targeting region -Reverse primer IDT CAACATGCAAAGCCCTGTCT Chr12 FISH probes Empire Genomics Cat#CHR12-10-GR MDM2 FISH probes Empire Genomics Cat#MDM2-20-OR Recombinant DNA pXPR_044, all in one CRISPR-Cas9 vector gift from John Doench and Dave Root Broad Institute, Genomics Perturbation Plat-form Software and algorithms Code supporting this study This paper https://github.com/BernsteinLab/ methods_mdm2_sarcoma; https://doi.org/10.5281/zenodo.7814766 STAR Dobin et al.78 version 2.7.10 Juicebox Durand et al.79 http://aidenlab.org/juicebox/ Hichipper Lareau et al.80 version 0.7.9 HiC-Pro Servant et al.81 version 2.10.0 Bioconductor Huber et al.582 Release 3.13 Homer Heinz et al.83 version 4.11 Samtools Danecek et al.84 version 1.15.1 Bedtools Quinlan et al.85 version 2.29.0 HTSlib Bonfield et al.86 version 1.15.1 FIJI Schindelin et al.87 version 2.0.0-rc-43/1.5h CellProfiler Stirling et al.88 version 4.2.1 SynergyFinder Ianevski et al.89 version 1.6.1 FlowJo BD biosciences version 10.8.0 Article ll OPEN ACCESS ..

    CRISPR:

    Article Title: Impact of supraphysiologic MDM2 expression on chromatin networks and therapeutic responses in sarcoma
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Actin Bio-Rad Cat#12004163, RRID:AB_2861334 H3K27ac Active Motif Cat#39133, RRID:AB_2561016 JUN Cell Signaling Cat#9165S, RRID:AB_2130165 MDM2 Abcam Cat#ab226939, RRID:AB_2754988 P53 Cell Signaling Cat#48818, RRID:AB_2713958 PML Santa Cruz Cat#sc-966, RRID:AB_628162 RUNX2 Cell Signaling Cat#12556S, RRID:AB_2732805 YY1 Santa Cruz Cat#sc-7341, RRID:AB_2257497 Drosophila spike-in chromatin antibody Active Motif Cat#61686, RRID:AB_2737370 Biological samples See Table S1 for a list of patient samples included in the study N/A Chemicals, peptides, and recombinant proteins HDM201 SelleckChem Cat#S8606 Nutlin-3a SelleckChem Cat#S8059 Navitoclax SelleckChem Cat#S1001 Klenow Fragment (3-5exo-) NEB Cat#M0212L Drosophila spike-in chromatin Active Motif Cat#53083 MboI NEB Cat# R0147M Biotin-dATP ThermoFisher Cat#195224016 Streptavidin M280 beads Invitrogen Cat#11205D RIPA buffer Life Technologies Cat#89900 HALT protease phosphatase inhibitor cocktail ThermoFisher Cat#78440 Cell Titer-Glo Promega Cat#G7570 16% Formaldehyde Life Technologies Cat#28908 Vectashield Vector labs Cat#H-1000-10 Fluoromount G Invitrogen Cat#00495802 KaryoMAX colcemid solution Life Technologies Cat#15212012 DAPI (40,6-Diamidino-2-Phenylindole, Dihydrochloride) Thermo Fisher Cat#D1306 Critical commercial assays QIAGEN RNeasy lipid kit Qiagen Cat#74804 End-It DNA repair kit Biosearch Technologies Cat#ER0720 KAPA HiFi HotStart ReadyMix PCR Kit Roche Cat#07958935001 Zymo Clean and Concentrate Kit Zymo Cat#DCC-100 Nextera DNA library prep kit Illumina Cat#20018704 BCA protein assay kit ThermoFisher Cat#23227 Dead cell apoptosis kit Invitrogen Cat#V13241 Deposited data Sequencing data This paper GEO: GSE213300 Human transcriptomic data derived from the TCGA Xena curated data repository https://pancanatlas.xenahubs.net H3K27ac HiChIP of normal tissues Mumbach et al.20 GEO: GSE101498 (Continued on next page) Cell Genomics 3, 100321, July 12, 2023 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines HCT116 ATCC CatCCL-247, RRID:CVCL_0291 U-2 OS ATCC Cat#HTB-96, RRID:CVCL_0042 LPS141 gift from Dr. Adrian Marino-Enriquez Brigham and Women’s Hospital LPS853 gift from Dr. Adrian Marino-Enriquez Brigham and Women’s Hospital 93T449 gift from Dr. Adrian Marino-Enriquez Brigham and Women’s Hospital 94T778 gift from Dr. Adrian Marino-Enriquez Brigham and Women’s Hospital Oligonucleotides Safe harbor sgRNA IDT GGCTAAATTCCTCTTATTCA TP53 sgRNA IDT TCGACGCTAGGATCTGACTG PCR of P53 CRISPR targeting region -Forward primer IDT CCCAACCCTTGTCCTTACCA PCR of P53 CRISPR targeting region -Reverse primer IDT CAACATGCAAAGCCCTGTCT Chr12 FISH probes Empire Genomics Cat#CHR12-10-GR MDM2 FISH probes Empire Genomics Cat#MDM2-20-OR Recombinant DNA pXPR_044, all in one CRISPR-Cas9 vector gift from John Doench and Dave Root Broad Institute, Genomics Perturbation Plat-form Software and algorithms Code supporting this study This paper https://github.com/BernsteinLab/ methods_mdm2_sarcoma; https://doi.org/10.5281/zenodo.7814766 STAR Dobin et al.78 version 2.7.10 Juicebox Durand et al.79 http://aidenlab.org/juicebox/ Hichipper Lareau et al.80 version 0.7.9 HiC-Pro Servant et al.81 version 2.10.0 Bioconductor Huber et al.582 Release 3.13 Homer Heinz et al.83 version 4.11 Samtools Danecek et al.84 version 1.15.1 Bedtools Quinlan et al.85 version 2.29.0 HTSlib Bonfield et al.86 version 1.15.1 FIJI Schindelin et al.87 version 2.0.0-rc-43/1.5h CellProfiler Stirling et al.88 version 4.2.1 SynergyFinder Ianevski et al.89 version 1.6.1 FlowJo BD biosciences version 10.8.0 Article ll OPEN ACCESS ..

    Fluorescence In Situ Hybridization:

    Article Title: Impact of supraphysiologic MDM2 expression on chromatin networks and therapeutic responses in sarcoma
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Actin Bio-Rad Cat#12004163, RRID:AB_2861334 H3K27ac Active Motif Cat#39133, RRID:AB_2561016 JUN Cell Signaling Cat#9165S, RRID:AB_2130165 MDM2 Abcam Cat#ab226939, RRID:AB_2754988 P53 Cell Signaling Cat#48818, RRID:AB_2713958 PML Santa Cruz Cat#sc-966, RRID:AB_628162 RUNX2 Cell Signaling Cat#12556S, RRID:AB_2732805 YY1 Santa Cruz Cat#sc-7341, RRID:AB_2257497 Drosophila spike-in chromatin antibody Active Motif Cat#61686, RRID:AB_2737370 Biological samples See Table S1 for a list of patient samples included in the study N/A Chemicals, peptides, and recombinant proteins HDM201 SelleckChem Cat#S8606 Nutlin-3a SelleckChem Cat#S8059 Navitoclax SelleckChem Cat#S1001 Klenow Fragment (3-5exo-) NEB Cat#M0212L Drosophila spike-in chromatin Active Motif Cat#53083 MboI NEB Cat# R0147M Biotin-dATP ThermoFisher Cat#195224016 Streptavidin M280 beads Invitrogen Cat#11205D RIPA buffer Life Technologies Cat#89900 HALT protease phosphatase inhibitor cocktail ThermoFisher Cat#78440 Cell Titer-Glo Promega Cat#G7570 16% Formaldehyde Life Technologies Cat#28908 Vectashield Vector labs Cat#H-1000-10 Fluoromount G Invitrogen Cat#00495802 KaryoMAX colcemid solution Life Technologies Cat#15212012 DAPI (40,6-Diamidino-2-Phenylindole, Dihydrochloride) Thermo Fisher Cat#D1306 Critical commercial assays QIAGEN RNeasy lipid kit Qiagen Cat#74804 End-It DNA repair kit Biosearch Technologies Cat#ER0720 KAPA HiFi HotStart ReadyMix PCR Kit Roche Cat#07958935001 Zymo Clean and Concentrate Kit Zymo Cat#DCC-100 Nextera DNA library prep kit Illumina Cat#20018704 BCA protein assay kit ThermoFisher Cat#23227 Dead cell apoptosis kit Invitrogen Cat#V13241 Deposited data Sequencing data This paper GEO: GSE213300 Human transcriptomic data derived from the TCGA Xena curated data repository https://pancanatlas.xenahubs.net H3K27ac HiChIP of normal tissues Mumbach et al.20 GEO: GSE101498 (Continued on next page) Cell Genomics 3, 100321, July 12, 2023 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines HCT116 ATCC CatCCL-247, RRID:CVCL_0291 U-2 OS ATCC Cat#HTB-96, RRID:CVCL_0042 LPS141 gift from Dr. Adrian Marino-Enriquez Brigham and Women’s Hospital LPS853 gift from Dr. Adrian Marino-Enriquez Brigham and Women’s Hospital 93T449 gift from Dr. Adrian Marino-Enriquez Brigham and Women’s Hospital 94T778 gift from Dr. Adrian Marino-Enriquez Brigham and Women’s Hospital Oligonucleotides Safe harbor sgRNA IDT GGCTAAATTCCTCTTATTCA TP53 sgRNA IDT TCGACGCTAGGATCTGACTG PCR of P53 CRISPR targeting region -Forward primer IDT CCCAACCCTTGTCCTTACCA PCR of P53 CRISPR targeting region -Reverse primer IDT CAACATGCAAAGCCCTGTCT Chr12 FISH probes Empire Genomics Cat#CHR12-10-GR MDM2 FISH probes Empire Genomics Cat#MDM2-20-OR Recombinant DNA pXPR_044, all in one CRISPR-Cas9 vector gift from John Doench and Dave Root Broad Institute, Genomics Perturbation Plat-form Software and algorithms Code supporting this study This paper https://github.com/BernsteinLab/ methods_mdm2_sarcoma; https://doi.org/10.5281/zenodo.7814766 STAR Dobin et al.78 version 2.7.10 Juicebox Durand et al.79 http://aidenlab.org/juicebox/ Hichipper Lareau et al.80 version 0.7.9 HiC-Pro Servant et al.81 version 2.10.0 Bioconductor Huber et al.582 Release 3.13 Homer Heinz et al.83 version 4.11 Samtools Danecek et al.84 version 1.15.1 Bedtools Quinlan et al.85 version 2.29.0 HTSlib Bonfield et al.86 version 1.15.1 FIJI Schindelin et al.87 version 2.0.0-rc-43/1.5h CellProfiler Stirling et al.88 version 4.2.1 SynergyFinder Ianevski et al.89 version 1.6.1 FlowJo BD biosciences version 10.8.0 Article ll OPEN ACCESS ..

    Plasmid Preparation:

    Article Title: Impact of supraphysiologic MDM2 expression on chromatin networks and therapeutic responses in sarcoma
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Actin Bio-Rad Cat#12004163, RRID:AB_2861334 H3K27ac Active Motif Cat#39133, RRID:AB_2561016 JUN Cell Signaling Cat#9165S, RRID:AB_2130165 MDM2 Abcam Cat#ab226939, RRID:AB_2754988 P53 Cell Signaling Cat#48818, RRID:AB_2713958 PML Santa Cruz Cat#sc-966, RRID:AB_628162 RUNX2 Cell Signaling Cat#12556S, RRID:AB_2732805 YY1 Santa Cruz Cat#sc-7341, RRID:AB_2257497 Drosophila spike-in chromatin antibody Active Motif Cat#61686, RRID:AB_2737370 Biological samples See Table S1 for a list of patient samples included in the study N/A Chemicals, peptides, and recombinant proteins HDM201 SelleckChem Cat#S8606 Nutlin-3a SelleckChem Cat#S8059 Navitoclax SelleckChem Cat#S1001 Klenow Fragment (3-5exo-) NEB Cat#M0212L Drosophila spike-in chromatin Active Motif Cat#53083 MboI NEB Cat# R0147M Biotin-dATP ThermoFisher Cat#195224016 Streptavidin M280 beads Invitrogen Cat#11205D RIPA buffer Life Technologies Cat#89900 HALT protease phosphatase inhibitor cocktail ThermoFisher Cat#78440 Cell Titer-Glo Promega Cat#G7570 16% Formaldehyde Life Technologies Cat#28908 Vectashield Vector labs Cat#H-1000-10 Fluoromount G Invitrogen Cat#00495802 KaryoMAX colcemid solution Life Technologies Cat#15212012 DAPI (40,6-Diamidino-2-Phenylindole, Dihydrochloride) Thermo Fisher Cat#D1306 Critical commercial assays QIAGEN RNeasy lipid kit Qiagen Cat#74804 End-It DNA repair kit Biosearch Technologies Cat#ER0720 KAPA HiFi HotStart ReadyMix PCR Kit Roche Cat#07958935001 Zymo Clean and Concentrate Kit Zymo Cat#DCC-100 Nextera DNA library prep kit Illumina Cat#20018704 BCA protein assay kit ThermoFisher Cat#23227 Dead cell apoptosis kit Invitrogen Cat#V13241 Deposited data Sequencing data This paper GEO: GSE213300 Human transcriptomic data derived from the TCGA Xena curated data repository https://pancanatlas.xenahubs.net H3K27ac HiChIP of normal tissues Mumbach et al.20 GEO: GSE101498 (Continued on next page) Cell Genomics 3, 100321, July 12, 2023 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines HCT116 ATCC CatCCL-247, RRID:CVCL_0291 U-2 OS ATCC Cat#HTB-96, RRID:CVCL_0042 LPS141 gift from Dr. Adrian Marino-Enriquez Brigham and Women’s Hospital LPS853 gift from Dr. Adrian Marino-Enriquez Brigham and Women’s Hospital 93T449 gift from Dr. Adrian Marino-Enriquez Brigham and Women’s Hospital 94T778 gift from Dr. Adrian Marino-Enriquez Brigham and Women’s Hospital Oligonucleotides Safe harbor sgRNA IDT GGCTAAATTCCTCTTATTCA TP53 sgRNA IDT TCGACGCTAGGATCTGACTG PCR of P53 CRISPR targeting region -Forward primer IDT CCCAACCCTTGTCCTTACCA PCR of P53 CRISPR targeting region -Reverse primer IDT CAACATGCAAAGCCCTGTCT Chr12 FISH probes Empire Genomics Cat#CHR12-10-GR MDM2 FISH probes Empire Genomics Cat#MDM2-20-OR Recombinant DNA pXPR_044, all in one CRISPR-Cas9 vector gift from John Doench and Dave Root Broad Institute, Genomics Perturbation Plat-form Software and algorithms Code supporting this study This paper https://github.com/BernsteinLab/ methods_mdm2_sarcoma; https://doi.org/10.5281/zenodo.7814766 STAR Dobin et al.78 version 2.7.10 Juicebox Durand et al.79 http://aidenlab.org/juicebox/ Hichipper Lareau et al.80 version 0.7.9 HiC-Pro Servant et al.81 version 2.10.0 Bioconductor Huber et al.582 Release 3.13 Homer Heinz et al.83 version 4.11 Samtools Danecek et al.84 version 1.15.1 Bedtools Quinlan et al.85 version 2.29.0 HTSlib Bonfield et al.86 version 1.15.1 FIJI Schindelin et al.87 version 2.0.0-rc-43/1.5h CellProfiler Stirling et al.88 version 4.2.1 SynergyFinder Ianevski et al.89 version 1.6.1 FlowJo BD biosciences version 10.8.0 Article ll OPEN ACCESS ..

    Software:

    Article Title: Impact of supraphysiologic MDM2 expression on chromatin networks and therapeutic responses in sarcoma
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Actin Bio-Rad Cat#12004163, RRID:AB_2861334 H3K27ac Active Motif Cat#39133, RRID:AB_2561016 JUN Cell Signaling Cat#9165S, RRID:AB_2130165 MDM2 Abcam Cat#ab226939, RRID:AB_2754988 P53 Cell Signaling Cat#48818, RRID:AB_2713958 PML Santa Cruz Cat#sc-966, RRID:AB_628162 RUNX2 Cell Signaling Cat#12556S, RRID:AB_2732805 YY1 Santa Cruz Cat#sc-7341, RRID:AB_2257497 Drosophila spike-in chromatin antibody Active Motif Cat#61686, RRID:AB_2737370 Biological samples See Table S1 for a list of patient samples included in the study N/A Chemicals, peptides, and recombinant proteins HDM201 SelleckChem Cat#S8606 Nutlin-3a SelleckChem Cat#S8059 Navitoclax SelleckChem Cat#S1001 Klenow Fragment (3-5exo-) NEB Cat#M0212L Drosophila spike-in chromatin Active Motif Cat#53083 MboI NEB Cat# R0147M Biotin-dATP ThermoFisher Cat#195224016 Streptavidin M280 beads Invitrogen Cat#11205D RIPA buffer Life Technologies Cat#89900 HALT protease phosphatase inhibitor cocktail ThermoFisher Cat#78440 Cell Titer-Glo Promega Cat#G7570 16% Formaldehyde Life Technologies Cat#28908 Vectashield Vector labs Cat#H-1000-10 Fluoromount G Invitrogen Cat#00495802 KaryoMAX colcemid solution Life Technologies Cat#15212012 DAPI (40,6-Diamidino-2-Phenylindole, Dihydrochloride) Thermo Fisher Cat#D1306 Critical commercial assays QIAGEN RNeasy lipid kit Qiagen Cat#74804 End-It DNA repair kit Biosearch Technologies Cat#ER0720 KAPA HiFi HotStart ReadyMix PCR Kit Roche Cat#07958935001 Zymo Clean and Concentrate Kit Zymo Cat#DCC-100 Nextera DNA library prep kit Illumina Cat#20018704 BCA protein assay kit ThermoFisher Cat#23227 Dead cell apoptosis kit Invitrogen Cat#V13241 Deposited data Sequencing data This paper GEO: GSE213300 Human transcriptomic data derived from the TCGA Xena curated data repository https://pancanatlas.xenahubs.net H3K27ac HiChIP of normal tissues Mumbach et al.20 GEO: GSE101498 (Continued on next page) Cell Genomics 3, 100321, July 12, 2023 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines HCT116 ATCC CatCCL-247, RRID:CVCL_0291 U-2 OS ATCC Cat#HTB-96, RRID:CVCL_0042 LPS141 gift from Dr. Adrian Marino-Enriquez Brigham and Women’s Hospital LPS853 gift from Dr. Adrian Marino-Enriquez Brigham and Women’s Hospital 93T449 gift from Dr. Adrian Marino-Enriquez Brigham and Women’s Hospital 94T778 gift from Dr. Adrian Marino-Enriquez Brigham and Women’s Hospital Oligonucleotides Safe harbor sgRNA IDT GGCTAAATTCCTCTTATTCA TP53 sgRNA IDT TCGACGCTAGGATCTGACTG PCR of P53 CRISPR targeting region -Forward primer IDT CCCAACCCTTGTCCTTACCA PCR of P53 CRISPR targeting region -Reverse primer IDT CAACATGCAAAGCCCTGTCT Chr12 FISH probes Empire Genomics Cat#CHR12-10-GR MDM2 FISH probes Empire Genomics Cat#MDM2-20-OR Recombinant DNA pXPR_044, all in one CRISPR-Cas9 vector gift from John Doench and Dave Root Broad Institute, Genomics Perturbation Plat-form Software and algorithms Code supporting this study This paper https://github.com/BernsteinLab/ methods_mdm2_sarcoma; https://doi.org/10.5281/zenodo.7814766 STAR Dobin et al.78 version 2.7.10 Juicebox Durand et al.79 http://aidenlab.org/juicebox/ Hichipper Lareau et al.80 version 0.7.9 HiC-Pro Servant et al.81 version 2.10.0 Bioconductor Huber et al.582 Release 3.13 Homer Heinz et al.83 version 4.11 Samtools Danecek et al.84 version 1.15.1 Bedtools Quinlan et al.85 version 2.29.0 HTSlib Bonfield et al.86 version 1.15.1 FIJI Schindelin et al.87 version 2.0.0-rc-43/1.5h CellProfiler Stirling et al.88 version 4.2.1 SynergyFinder Ianevski et al.89 version 1.6.1 FlowJo BD biosciences version 10.8.0 Article ll OPEN ACCESS ..

    Magnetic Beads:

    Article Title: TRMT1L-catalyzed m 2 2 G27 on tyrosine tRNA is required for efficient mRNA translation and cell survival under oxidative stress.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-PELP1 Antibody Bethyl Cat#A300-180A; RRID: AB_242526 Rabbit anti-TRMT1L Antibody Bethyl Cat#A305-120A; RRID: AB_2631515 Mouse anti-TRMT1L Antibody Sigma-Aldrich Cat#SAB1408048; RRID: AB_10741695 Rabbit anti-SENP3 Antibody Cell Signaling Technology Cat#5591; RRID: AB_10694546 Rabbit anti-WDR18 Antibody Castle et al.25 N/A Mouse anti-NPM1 Antibody Santa Cruz Biotechnology Cat#sc-56622; RRID: AB_784888 Mouse anti-uL5 (RPL11) Antibody Sigma-Aldrich Cat#SAB1402896; RRID: AB_10738164 Mouse c-Myc Antibody (9E10) Santa Cruz Biotechnology Cat#sc-40; RRID: AB_627268 Rabbit anti-TRMT1 Antibody Bethyl Cat#A304-205A; RRID: AB_2620402 Rabbit anti-Fibrillarin Antibody Bethyl Cat#A303-891A; RRID: AB_2620241 Rabbit anti-DDX21 Antibody Bethyl Cat#A300-627A; RRID: AB_513601 Rabbit anti-N2,N2-dimethylguanosine (m2,2G) Antibody Abcam Cat#ab211488; RRID: AB_3532174 Rabbit IgG Normal Millipore Cat#NI01; RRID: AB_490574 Mouse anti-GAPDH Antibody Santa Cruz Biotechnology Cat#sc-47724; RRID: AB_627678 Mouse anti-puromycin antibody DSHB Cat#PMY-2A4; RRID: AB_2619605 Goat anti-Mouse IgG (H + L) Secondary Antibody, Alexa FluorTM 488 Thermo Fisher Scientific Cat#A-11001; RRID: AB_2534069 Goat anti-Rabbit IgG (H + L) Secondary Antibody, Alexa FluorTM 594 Thermo Fisher Scientific Cat#A-11012; RRID: AB_2534079 Chemicals, peptides, and recombinant proteins Amersham Hybond N+ nylon membrane GE Healthcare RPN303B AMPure RNAClean XP beads Beckman Coulter A63987 AMV Reverse Transcriptase Promega M510A AMV Reverse Transcriptase 5X Reaction Buffer Promega M515A Aprotinin Fisher BP250310 AEBSF Fisher BP635-500 CX-5461 Cellagen Technologies C2954-2s DMEM (no glucose) Gibco 11966025 Exonuclease I NEB M0293S FastAP Thermosensitive Alkaline Phosphatase Thermo Scientific EF0651 Fetal bovine serum Hyclone SV30014.03 High glucose DMEM HyClone SH30022.01 Immun-Star AP substrate Bio-rad 1705018 Lipofectamine RNAi Max Invitrogen 13778150 Murine RNase inhibitor NEB M0314 Penicillin-Streptomycin Hyclone SH40003.01 Protease inhibitor cocktail Thermo Scientific 78437 Protinase K Invitrogen 46–7185 Protein G Dynabeads Invitrogen 10003D Puromycin Sigma P8833 pCp-Biotin Jena Bioscience NU-1706-Bio (Continued on next page) 18 Cell Reports 44, 115167, January 28, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant protein G Sepharose beads Invitrogen 101242 RNase T1 Thermo Scientific EN0541 Streptavidin-alkaline phosophatase conjugate Invitrogen 434322 Streptavidin Magnetic Beads NEB S1420S Streptavidin-IR800 LI-COR 926–32230 SYBR Gold Nucleic Acid Gel Stain Invitrogen S11494 Thapsigargin Sigma 586006 SuperScript IV Reverse Transcriptase Invitrogen 18090010 TRIzol reagent Invitrogen 15596026 Turbo DNase Invitrogen AM2239 TurboDNase buffer Invitrogen AM2238 T4 polynucleotide kinase NEB M0201S T4 polynucleotide kinase reaction buffer NEB B0201S T4 RNA ligase NEB M0204S T4 RNA ligase 2 NEB M0239S Leupeptin Fisher PI78435 [g-32P]ATP Perkin-Elmer NEG502A250UC Nitrocellulose membrane Bio-rad 1620115 anti-DYKDDDDK Magnetic Agarose Pierce A36797 3x DYKDDDDK Peptide Pierce A36805 MAXIscriptTM T7 Transcription Kit Invitrogen AM1312 S-adenosylmethionine (SAM) NEB B9003S Critical commercial assays EconoFit Macro-Prep DEAE columns BioRad 12009274 G50 spin column Cytiva 27533001 Q5 Site-Directed Mutagenesis Kit NEB E0554S Silver stain kit Pierce 24612 BCA assay kit Pierce 23225 Direct RNA Sequencing Kit Oxford Nanopore technologies SQK-RNA002 Monarch RNA Cleanup kit NEB T2030L Zymoclean Gel RNA Recovery Kit Zymo research R1011 Deposited data eCLIP-seq raw and analyzed data This paper GEO: GSE266587 Nano-tRNAseq raw and analyzed data This paper GEO: GSE266588 Proteomic analysis of PELP1 (RIX1) interactome This paper MassIVE: MSV000096583 Experimental models: Cell lines HCT116 ATCC CatCCL-247; RRID: CVCL_0291 HeLa ATCC Cat#CCL-2; RRID: CVCL_0030 HT-1080 ATCC Cat#CCL-121; RRID: CVCL_0317 U2OS ATCC Cat#HTB-96; RRID: CVCL_0042 HEK293T ATCC Cat#CRL-3216; RRID: CVCL_0063 HCT116-WT (non-targeting sgRNA) This study N/A HCT116-TRMT1L KO#1 (TRMT1L sgRNA-1) This study N/A HCT116-TRMT1L KO#2 (TRMT1L sgRNA-2) This study N/A HCT116-WT (non-targeting sgRNA)+Empty This study N/A (Continued on next page) Cell Reports 44, 115167, January 28, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER HCT116-TRMT1L KO#1+Empty This study N/A HCT116-TRMT1L KO#1+TRMT1L WT This study N/A HCT116-TRMT1L KO#1+TRMT1L D373V This study N/A Oligonucleotides See Table S4 for oligonucleotides This study N/A Recombinant DNA pLentiCRISPR v2 Sanjana et al.83 Addgene plasmid #52961; http://n2t.net/ addgene:52961; RRID: Addgene_52961 pCMV-Myc Clontech Cat#631604 pLenti-CMV-GFP-Hygro Campeau et al.84 Addgene plasmid #17446; http://n2t.net/ addgene:17446; RRID: Addgene_17446 p3XFLAG-CMV-7.1 Sigma Cat#E7533 pCMV-Myc-TRMT1L This study N/A pCMV-Myc-TRMT1L mNLS This study N/A pCMV-Myc-TRMT1L mNoLS This study N/A pLenti-CMV-TRMT1L-Hygro This study N/A pLenti-CMV-TRMT1L D373V-Hygro This study N/A pLenti-CMV-Empty-Hygro This study N/A p3xFLAG-CMV-TRMT1L This study N/A p3xFLAG-CMV-TRMT1L D373V This study N/A plentiCRISPR v2-non targeting sgRNA This study N/A plentiCRISPR v2-TRMT1L sgRNA-1 This study N/A plentiCRISPR v2-TRMT1L sgRNA-2 This study N/A Software and algorithms ImageJ Schneider et al.85 https://imagej.net/software/fiji/ Bowtie2 Langmead and Salzberg86 http://bowtie-bio.sourceforge.net/bowtie2/ index.shtml Samtools Li & Li et al.87,88 http://samtools.sourceforge.net/ cNLS Mapper Kosugi et al.29 https://nls-mapper.iab.keio.ac.jp/cgi-bin/ NLS_Mapper_form.cgi NoD tool Scott et al. & Scott et al.27,28 https://www.compbio.dundee.ac.uk/www- nod/ Mongo Oligo Mass Calculator v2.06 Rozenski et al.89 http://rna.rega.kuleuven.be/masspec/ mongo.htm CutAdapt Martin90 https://cutadapt.readthedocs.io/en/stable/ fastp Chen et al.91 https://github.com/OpenGene/fastp PEAKachu peak calling tool Bischler et al.92 https://github.com/tbischler/PEAKachu UMI-tools Smith et al.93 https://github.com/CGATOxford/UMI-tools Burrows-Wheeler Aligner (BWA) Li and Durbin94 https://bio-bwa.sourceforge.net/ BEDTools Quinlan and Hall95 https://github.com/arq5x/bedtools2/ releases Integrative Genomics Viewer (IGV) Thorvaldsdottir et al.96 https://igv.org/doc/desktop/ CHOPCHOP Labun et al.97 https://chopchop.cbu.uib.no/

    Reverse Transcription:

    Article Title: TRMT1L-catalyzed m 2 2 G27 on tyrosine tRNA is required for efficient mRNA translation and cell survival under oxidative stress.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-PELP1 Antibody Bethyl Cat#A300-180A; RRID: AB_242526 Rabbit anti-TRMT1L Antibody Bethyl Cat#A305-120A; RRID: AB_2631515 Mouse anti-TRMT1L Antibody Sigma-Aldrich Cat#SAB1408048; RRID: AB_10741695 Rabbit anti-SENP3 Antibody Cell Signaling Technology Cat#5591; RRID: AB_10694546 Rabbit anti-WDR18 Antibody Castle et al.25 N/A Mouse anti-NPM1 Antibody Santa Cruz Biotechnology Cat#sc-56622; RRID: AB_784888 Mouse anti-uL5 (RPL11) Antibody Sigma-Aldrich Cat#SAB1402896; RRID: AB_10738164 Mouse c-Myc Antibody (9E10) Santa Cruz Biotechnology Cat#sc-40; RRID: AB_627268 Rabbit anti-TRMT1 Antibody Bethyl Cat#A304-205A; RRID: AB_2620402 Rabbit anti-Fibrillarin Antibody Bethyl Cat#A303-891A; RRID: AB_2620241 Rabbit anti-DDX21 Antibody Bethyl Cat#A300-627A; RRID: AB_513601 Rabbit anti-N2,N2-dimethylguanosine (m2,2G) Antibody Abcam Cat#ab211488; RRID: AB_3532174 Rabbit IgG Normal Millipore Cat#NI01; RRID: AB_490574 Mouse anti-GAPDH Antibody Santa Cruz Biotechnology Cat#sc-47724; RRID: AB_627678 Mouse anti-puromycin antibody DSHB Cat#PMY-2A4; RRID: AB_2619605 Goat anti-Mouse IgG (H + L) Secondary Antibody, Alexa FluorTM 488 Thermo Fisher Scientific Cat#A-11001; RRID: AB_2534069 Goat anti-Rabbit IgG (H + L) Secondary Antibody, Alexa FluorTM 594 Thermo Fisher Scientific Cat#A-11012; RRID: AB_2534079 Chemicals, peptides, and recombinant proteins Amersham Hybond N+ nylon membrane GE Healthcare RPN303B AMPure RNAClean XP beads Beckman Coulter A63987 AMV Reverse Transcriptase Promega M510A AMV Reverse Transcriptase 5X Reaction Buffer Promega M515A Aprotinin Fisher BP250310 AEBSF Fisher BP635-500 CX-5461 Cellagen Technologies C2954-2s DMEM (no glucose) Gibco 11966025 Exonuclease I NEB M0293S FastAP Thermosensitive Alkaline Phosphatase Thermo Scientific EF0651 Fetal bovine serum Hyclone SV30014.03 High glucose DMEM HyClone SH30022.01 Immun-Star AP substrate Bio-rad 1705018 Lipofectamine RNAi Max Invitrogen 13778150 Murine RNase inhibitor NEB M0314 Penicillin-Streptomycin Hyclone SH40003.01 Protease inhibitor cocktail Thermo Scientific 78437 Protinase K Invitrogen 46–7185 Protein G Dynabeads Invitrogen 10003D Puromycin Sigma P8833 pCp-Biotin Jena Bioscience NU-1706-Bio (Continued on next page) 18 Cell Reports 44, 115167, January 28, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant protein G Sepharose beads Invitrogen 101242 RNase T1 Thermo Scientific EN0541 Streptavidin-alkaline phosophatase conjugate Invitrogen 434322 Streptavidin Magnetic Beads NEB S1420S Streptavidin-IR800 LI-COR 926–32230 SYBR Gold Nucleic Acid Gel Stain Invitrogen S11494 Thapsigargin Sigma 586006 SuperScript IV Reverse Transcriptase Invitrogen 18090010 TRIzol reagent Invitrogen 15596026 Turbo DNase Invitrogen AM2239 TurboDNase buffer Invitrogen AM2238 T4 polynucleotide kinase NEB M0201S T4 polynucleotide kinase reaction buffer NEB B0201S T4 RNA ligase NEB M0204S T4 RNA ligase 2 NEB M0239S Leupeptin Fisher PI78435 [g-32P]ATP Perkin-Elmer NEG502A250UC Nitrocellulose membrane Bio-rad 1620115 anti-DYKDDDDK Magnetic Agarose Pierce A36797 3x DYKDDDDK Peptide Pierce A36805 MAXIscriptTM T7 Transcription Kit Invitrogen AM1312 S-adenosylmethionine (SAM) NEB B9003S Critical commercial assays EconoFit Macro-Prep DEAE columns BioRad 12009274 G50 spin column Cytiva 27533001 Q5 Site-Directed Mutagenesis Kit NEB E0554S Silver stain kit Pierce 24612 BCA assay kit Pierce 23225 Direct RNA Sequencing Kit Oxford Nanopore technologies SQK-RNA002 Monarch RNA Cleanup kit NEB T2030L Zymoclean Gel RNA Recovery Kit Zymo research R1011 Deposited data eCLIP-seq raw and analyzed data This paper GEO: GSE266587 Nano-tRNAseq raw and analyzed data This paper GEO: GSE266588 Proteomic analysis of PELP1 (RIX1) interactome This paper MassIVE: MSV000096583 Experimental models: Cell lines HCT116 ATCC CatCCL-247; RRID: CVCL_0291 HeLa ATCC Cat#CCL-2; RRID: CVCL_0030 HT-1080 ATCC Cat#CCL-121; RRID: CVCL_0317 U2OS ATCC Cat#HTB-96; RRID: CVCL_0042 HEK293T ATCC Cat#CRL-3216; RRID: CVCL_0063 HCT116-WT (non-targeting sgRNA) This study N/A HCT116-TRMT1L KO#1 (TRMT1L sgRNA-1) This study N/A HCT116-TRMT1L KO#2 (TRMT1L sgRNA-2) This study N/A HCT116-WT (non-targeting sgRNA)+Empty This study N/A (Continued on next page) Cell Reports 44, 115167, January 28, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER HCT116-TRMT1L KO#1+Empty This study N/A HCT116-TRMT1L KO#1+TRMT1L WT This study N/A HCT116-TRMT1L KO#1+TRMT1L D373V This study N/A Oligonucleotides See Table S4 for oligonucleotides This study N/A Recombinant DNA pLentiCRISPR v2 Sanjana et al.83 Addgene plasmid #52961; http://n2t.net/ addgene:52961; RRID: Addgene_52961 pCMV-Myc Clontech Cat#631604 pLenti-CMV-GFP-Hygro Campeau et al.84 Addgene plasmid #17446; http://n2t.net/ addgene:17446; RRID: Addgene_17446 p3XFLAG-CMV-7.1 Sigma Cat#E7533 pCMV-Myc-TRMT1L This study N/A pCMV-Myc-TRMT1L mNLS This study N/A pCMV-Myc-TRMT1L mNoLS This study N/A pLenti-CMV-TRMT1L-Hygro This study N/A pLenti-CMV-TRMT1L D373V-Hygro This study N/A pLenti-CMV-Empty-Hygro This study N/A p3xFLAG-CMV-TRMT1L This study N/A p3xFLAG-CMV-TRMT1L D373V This study N/A plentiCRISPR v2-non targeting sgRNA This study N/A plentiCRISPR v2-TRMT1L sgRNA-1 This study N/A plentiCRISPR v2-TRMT1L sgRNA-2 This study N/A Software and algorithms ImageJ Schneider et al.85 https://imagej.net/software/fiji/ Bowtie2 Langmead and Salzberg86 http://bowtie-bio.sourceforge.net/bowtie2/ index.shtml Samtools Li & Li et al.87,88 http://samtools.sourceforge.net/ cNLS Mapper Kosugi et al.29 https://nls-mapper.iab.keio.ac.jp/cgi-bin/ NLS_Mapper_form.cgi NoD tool Scott et al. & Scott et al.27,28 https://www.compbio.dundee.ac.uk/www- nod/ Mongo Oligo Mass Calculator v2.06 Rozenski et al.89 http://rna.rega.kuleuven.be/masspec/ mongo.htm CutAdapt Martin90 https://cutadapt.readthedocs.io/en/stable/ fastp Chen et al.91 https://github.com/OpenGene/fastp PEAKachu peak calling tool Bischler et al.92 https://github.com/tbischler/PEAKachu UMI-tools Smith et al.93 https://github.com/CGATOxford/UMI-tools Burrows-Wheeler Aligner (BWA) Li and Durbin94 https://bio-bwa.sourceforge.net/ BEDTools Quinlan and Hall95 https://github.com/arq5x/bedtools2/ releases Integrative Genomics Viewer (IGV) Thorvaldsdottir et al.96 https://igv.org/doc/desktop/ CHOPCHOP Labun et al.97 https://chopchop.cbu.uib.no/

    Membrane:

    Article Title: TRMT1L-catalyzed m 2 2 G27 on tyrosine tRNA is required for efficient mRNA translation and cell survival under oxidative stress.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-PELP1 Antibody Bethyl Cat#A300-180A; RRID: AB_242526 Rabbit anti-TRMT1L Antibody Bethyl Cat#A305-120A; RRID: AB_2631515 Mouse anti-TRMT1L Antibody Sigma-Aldrich Cat#SAB1408048; RRID: AB_10741695 Rabbit anti-SENP3 Antibody Cell Signaling Technology Cat#5591; RRID: AB_10694546 Rabbit anti-WDR18 Antibody Castle et al.25 N/A Mouse anti-NPM1 Antibody Santa Cruz Biotechnology Cat#sc-56622; RRID: AB_784888 Mouse anti-uL5 (RPL11) Antibody Sigma-Aldrich Cat#SAB1402896; RRID: AB_10738164 Mouse c-Myc Antibody (9E10) Santa Cruz Biotechnology Cat#sc-40; RRID: AB_627268 Rabbit anti-TRMT1 Antibody Bethyl Cat#A304-205A; RRID: AB_2620402 Rabbit anti-Fibrillarin Antibody Bethyl Cat#A303-891A; RRID: AB_2620241 Rabbit anti-DDX21 Antibody Bethyl Cat#A300-627A; RRID: AB_513601 Rabbit anti-N2,N2-dimethylguanosine (m2,2G) Antibody Abcam Cat#ab211488; RRID: AB_3532174 Rabbit IgG Normal Millipore Cat#NI01; RRID: AB_490574 Mouse anti-GAPDH Antibody Santa Cruz Biotechnology Cat#sc-47724; RRID: AB_627678 Mouse anti-puromycin antibody DSHB Cat#PMY-2A4; RRID: AB_2619605 Goat anti-Mouse IgG (H + L) Secondary Antibody, Alexa FluorTM 488 Thermo Fisher Scientific Cat#A-11001; RRID: AB_2534069 Goat anti-Rabbit IgG (H + L) Secondary Antibody, Alexa FluorTM 594 Thermo Fisher Scientific Cat#A-11012; RRID: AB_2534079 Chemicals, peptides, and recombinant proteins Amersham Hybond N+ nylon membrane GE Healthcare RPN303B AMPure RNAClean XP beads Beckman Coulter A63987 AMV Reverse Transcriptase Promega M510A AMV Reverse Transcriptase 5X Reaction Buffer Promega M515A Aprotinin Fisher BP250310 AEBSF Fisher BP635-500 CX-5461 Cellagen Technologies C2954-2s DMEM (no glucose) Gibco 11966025 Exonuclease I NEB M0293S FastAP Thermosensitive Alkaline Phosphatase Thermo Scientific EF0651 Fetal bovine serum Hyclone SV30014.03 High glucose DMEM HyClone SH30022.01 Immun-Star AP substrate Bio-rad 1705018 Lipofectamine RNAi Max Invitrogen 13778150 Murine RNase inhibitor NEB M0314 Penicillin-Streptomycin Hyclone SH40003.01 Protease inhibitor cocktail Thermo Scientific 78437 Protinase K Invitrogen 46–7185 Protein G Dynabeads Invitrogen 10003D Puromycin Sigma P8833 pCp-Biotin Jena Bioscience NU-1706-Bio (Continued on next page) 18 Cell Reports 44, 115167, January 28, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant protein G Sepharose beads Invitrogen 101242 RNase T1 Thermo Scientific EN0541 Streptavidin-alkaline phosophatase conjugate Invitrogen 434322 Streptavidin Magnetic Beads NEB S1420S Streptavidin-IR800 LI-COR 926–32230 SYBR Gold Nucleic Acid Gel Stain Invitrogen S11494 Thapsigargin Sigma 586006 SuperScript IV Reverse Transcriptase Invitrogen 18090010 TRIzol reagent Invitrogen 15596026 Turbo DNase Invitrogen AM2239 TurboDNase buffer Invitrogen AM2238 T4 polynucleotide kinase NEB M0201S T4 polynucleotide kinase reaction buffer NEB B0201S T4 RNA ligase NEB M0204S T4 RNA ligase 2 NEB M0239S Leupeptin Fisher PI78435 [g-32P]ATP Perkin-Elmer NEG502A250UC Nitrocellulose membrane Bio-rad 1620115 anti-DYKDDDDK Magnetic Agarose Pierce A36797 3x DYKDDDDK Peptide Pierce A36805 MAXIscriptTM T7 Transcription Kit Invitrogen AM1312 S-adenosylmethionine (SAM) NEB B9003S Critical commercial assays EconoFit Macro-Prep DEAE columns BioRad 12009274 G50 spin column Cytiva 27533001 Q5 Site-Directed Mutagenesis Kit NEB E0554S Silver stain kit Pierce 24612 BCA assay kit Pierce 23225 Direct RNA Sequencing Kit Oxford Nanopore technologies SQK-RNA002 Monarch RNA Cleanup kit NEB T2030L Zymoclean Gel RNA Recovery Kit Zymo research R1011 Deposited data eCLIP-seq raw and analyzed data This paper GEO: GSE266587 Nano-tRNAseq raw and analyzed data This paper GEO: GSE266588 Proteomic analysis of PELP1 (RIX1) interactome This paper MassIVE: MSV000096583 Experimental models: Cell lines HCT116 ATCC CatCCL-247; RRID: CVCL_0291 HeLa ATCC Cat#CCL-2; RRID: CVCL_0030 HT-1080 ATCC Cat#CCL-121; RRID: CVCL_0317 U2OS ATCC Cat#HTB-96; RRID: CVCL_0042 HEK293T ATCC Cat#CRL-3216; RRID: CVCL_0063 HCT116-WT (non-targeting sgRNA) This study N/A HCT116-TRMT1L KO#1 (TRMT1L sgRNA-1) This study N/A HCT116-TRMT1L KO#2 (TRMT1L sgRNA-2) This study N/A HCT116-WT (non-targeting sgRNA)+Empty This study N/A (Continued on next page) Cell Reports 44, 115167, January 28, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER HCT116-TRMT1L KO#1+Empty This study N/A HCT116-TRMT1L KO#1+TRMT1L WT This study N/A HCT116-TRMT1L KO#1+TRMT1L D373V This study N/A Oligonucleotides See Table S4 for oligonucleotides This study N/A Recombinant DNA pLentiCRISPR v2 Sanjana et al.83 Addgene plasmid #52961; http://n2t.net/ addgene:52961; RRID: Addgene_52961 pCMV-Myc Clontech Cat#631604 pLenti-CMV-GFP-Hygro Campeau et al.84 Addgene plasmid #17446; http://n2t.net/ addgene:17446; RRID: Addgene_17446 p3XFLAG-CMV-7.1 Sigma Cat#E7533 pCMV-Myc-TRMT1L This study N/A pCMV-Myc-TRMT1L mNLS This study N/A pCMV-Myc-TRMT1L mNoLS This study N/A pLenti-CMV-TRMT1L-Hygro This study N/A pLenti-CMV-TRMT1L D373V-Hygro This study N/A pLenti-CMV-Empty-Hygro This study N/A p3xFLAG-CMV-TRMT1L This study N/A p3xFLAG-CMV-TRMT1L D373V This study N/A plentiCRISPR v2-non targeting sgRNA This study N/A plentiCRISPR v2-TRMT1L sgRNA-1 This study N/A plentiCRISPR v2-TRMT1L sgRNA-2 This study N/A Software and algorithms ImageJ Schneider et al.85 https://imagej.net/software/fiji/ Bowtie2 Langmead and Salzberg86 http://bowtie-bio.sourceforge.net/bowtie2/ index.shtml Samtools Li & Li et al.87,88 http://samtools.sourceforge.net/ cNLS Mapper Kosugi et al.29 https://nls-mapper.iab.keio.ac.jp/cgi-bin/ NLS_Mapper_form.cgi NoD tool Scott et al. & Scott et al.27,28 https://www.compbio.dundee.ac.uk/www- nod/ Mongo Oligo Mass Calculator v2.06 Rozenski et al.89 http://rna.rega.kuleuven.be/masspec/ mongo.htm CutAdapt Martin90 https://cutadapt.readthedocs.io/en/stable/ fastp Chen et al.91 https://github.com/OpenGene/fastp PEAKachu peak calling tool Bischler et al.92 https://github.com/tbischler/PEAKachu UMI-tools Smith et al.93 https://github.com/CGATOxford/UMI-tools Burrows-Wheeler Aligner (BWA) Li and Durbin94 https://bio-bwa.sourceforge.net/ BEDTools Quinlan and Hall95 https://github.com/arq5x/bedtools2/ releases Integrative Genomics Viewer (IGV) Thorvaldsdottir et al.96 https://igv.org/doc/desktop/ CHOPCHOP Labun et al.97 https://chopchop.cbu.uib.no/

    Mutagenesis:

    Article Title: TRMT1L-catalyzed m 2 2 G27 on tyrosine tRNA is required for efficient mRNA translation and cell survival under oxidative stress.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-PELP1 Antibody Bethyl Cat#A300-180A; RRID: AB_242526 Rabbit anti-TRMT1L Antibody Bethyl Cat#A305-120A; RRID: AB_2631515 Mouse anti-TRMT1L Antibody Sigma-Aldrich Cat#SAB1408048; RRID: AB_10741695 Rabbit anti-SENP3 Antibody Cell Signaling Technology Cat#5591; RRID: AB_10694546 Rabbit anti-WDR18 Antibody Castle et al.25 N/A Mouse anti-NPM1 Antibody Santa Cruz Biotechnology Cat#sc-56622; RRID: AB_784888 Mouse anti-uL5 (RPL11) Antibody Sigma-Aldrich Cat#SAB1402896; RRID: AB_10738164 Mouse c-Myc Antibody (9E10) Santa Cruz Biotechnology Cat#sc-40; RRID: AB_627268 Rabbit anti-TRMT1 Antibody Bethyl Cat#A304-205A; RRID: AB_2620402 Rabbit anti-Fibrillarin Antibody Bethyl Cat#A303-891A; RRID: AB_2620241 Rabbit anti-DDX21 Antibody Bethyl Cat#A300-627A; RRID: AB_513601 Rabbit anti-N2,N2-dimethylguanosine (m2,2G) Antibody Abcam Cat#ab211488; RRID: AB_3532174 Rabbit IgG Normal Millipore Cat#NI01; RRID: AB_490574 Mouse anti-GAPDH Antibody Santa Cruz Biotechnology Cat#sc-47724; RRID: AB_627678 Mouse anti-puromycin antibody DSHB Cat#PMY-2A4; RRID: AB_2619605 Goat anti-Mouse IgG (H + L) Secondary Antibody, Alexa FluorTM 488 Thermo Fisher Scientific Cat#A-11001; RRID: AB_2534069 Goat anti-Rabbit IgG (H + L) Secondary Antibody, Alexa FluorTM 594 Thermo Fisher Scientific Cat#A-11012; RRID: AB_2534079 Chemicals, peptides, and recombinant proteins Amersham Hybond N+ nylon membrane GE Healthcare RPN303B AMPure RNAClean XP beads Beckman Coulter A63987 AMV Reverse Transcriptase Promega M510A AMV Reverse Transcriptase 5X Reaction Buffer Promega M515A Aprotinin Fisher BP250310 AEBSF Fisher BP635-500 CX-5461 Cellagen Technologies C2954-2s DMEM (no glucose) Gibco 11966025 Exonuclease I NEB M0293S FastAP Thermosensitive Alkaline Phosphatase Thermo Scientific EF0651 Fetal bovine serum Hyclone SV30014.03 High glucose DMEM HyClone SH30022.01 Immun-Star AP substrate Bio-rad 1705018 Lipofectamine RNAi Max Invitrogen 13778150 Murine RNase inhibitor NEB M0314 Penicillin-Streptomycin Hyclone SH40003.01 Protease inhibitor cocktail Thermo Scientific 78437 Protinase K Invitrogen 46–7185 Protein G Dynabeads Invitrogen 10003D Puromycin Sigma P8833 pCp-Biotin Jena Bioscience NU-1706-Bio (Continued on next page) 18 Cell Reports 44, 115167, January 28, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant protein G Sepharose beads Invitrogen 101242 RNase T1 Thermo Scientific EN0541 Streptavidin-alkaline phosophatase conjugate Invitrogen 434322 Streptavidin Magnetic Beads NEB S1420S Streptavidin-IR800 LI-COR 926–32230 SYBR Gold Nucleic Acid Gel Stain Invitrogen S11494 Thapsigargin Sigma 586006 SuperScript IV Reverse Transcriptase Invitrogen 18090010 TRIzol reagent Invitrogen 15596026 Turbo DNase Invitrogen AM2239 TurboDNase buffer Invitrogen AM2238 T4 polynucleotide kinase NEB M0201S T4 polynucleotide kinase reaction buffer NEB B0201S T4 RNA ligase NEB M0204S T4 RNA ligase 2 NEB M0239S Leupeptin Fisher PI78435 [g-32P]ATP Perkin-Elmer NEG502A250UC Nitrocellulose membrane Bio-rad 1620115 anti-DYKDDDDK Magnetic Agarose Pierce A36797 3x DYKDDDDK Peptide Pierce A36805 MAXIscriptTM T7 Transcription Kit Invitrogen AM1312 S-adenosylmethionine (SAM) NEB B9003S Critical commercial assays EconoFit Macro-Prep DEAE columns BioRad 12009274 G50 spin column Cytiva 27533001 Q5 Site-Directed Mutagenesis Kit NEB E0554S Silver stain kit Pierce 24612 BCA assay kit Pierce 23225 Direct RNA Sequencing Kit Oxford Nanopore technologies SQK-RNA002 Monarch RNA Cleanup kit NEB T2030L Zymoclean Gel RNA Recovery Kit Zymo research R1011 Deposited data eCLIP-seq raw and analyzed data This paper GEO: GSE266587 Nano-tRNAseq raw and analyzed data This paper GEO: GSE266588 Proteomic analysis of PELP1 (RIX1) interactome This paper MassIVE: MSV000096583 Experimental models: Cell lines HCT116 ATCC CatCCL-247; RRID: CVCL_0291 HeLa ATCC Cat#CCL-2; RRID: CVCL_0030 HT-1080 ATCC Cat#CCL-121; RRID: CVCL_0317 U2OS ATCC Cat#HTB-96; RRID: CVCL_0042 HEK293T ATCC Cat#CRL-3216; RRID: CVCL_0063 HCT116-WT (non-targeting sgRNA) This study N/A HCT116-TRMT1L KO#1 (TRMT1L sgRNA-1) This study N/A HCT116-TRMT1L KO#2 (TRMT1L sgRNA-2) This study N/A HCT116-WT (non-targeting sgRNA)+Empty This study N/A (Continued on next page) Cell Reports 44, 115167, January 28, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER HCT116-TRMT1L KO#1+Empty This study N/A HCT116-TRMT1L KO#1+TRMT1L WT This study N/A HCT116-TRMT1L KO#1+TRMT1L D373V This study N/A Oligonucleotides See Table S4 for oligonucleotides This study N/A Recombinant DNA pLentiCRISPR v2 Sanjana et al.83 Addgene plasmid #52961; http://n2t.net/ addgene:52961; RRID: Addgene_52961 pCMV-Myc Clontech Cat#631604 pLenti-CMV-GFP-Hygro Campeau et al.84 Addgene plasmid #17446; http://n2t.net/ addgene:17446; RRID: Addgene_17446 p3XFLAG-CMV-7.1 Sigma Cat#E7533 pCMV-Myc-TRMT1L This study N/A pCMV-Myc-TRMT1L mNLS This study N/A pCMV-Myc-TRMT1L mNoLS This study N/A pLenti-CMV-TRMT1L-Hygro This study N/A pLenti-CMV-TRMT1L D373V-Hygro This study N/A pLenti-CMV-Empty-Hygro This study N/A p3xFLAG-CMV-TRMT1L This study N/A p3xFLAG-CMV-TRMT1L D373V This study N/A plentiCRISPR v2-non targeting sgRNA This study N/A plentiCRISPR v2-TRMT1L sgRNA-1 This study N/A plentiCRISPR v2-TRMT1L sgRNA-2 This study N/A Software and algorithms ImageJ Schneider et al.85 https://imagej.net/software/fiji/ Bowtie2 Langmead and Salzberg86 http://bowtie-bio.sourceforge.net/bowtie2/ index.shtml Samtools Li & Li et al.87,88 http://samtools.sourceforge.net/ cNLS Mapper Kosugi et al.29 https://nls-mapper.iab.keio.ac.jp/cgi-bin/ NLS_Mapper_form.cgi NoD tool Scott et al. & Scott et al.27,28 https://www.compbio.dundee.ac.uk/www- nod/ Mongo Oligo Mass Calculator v2.06 Rozenski et al.89 http://rna.rega.kuleuven.be/masspec/ mongo.htm CutAdapt Martin90 https://cutadapt.readthedocs.io/en/stable/ fastp Chen et al.91 https://github.com/OpenGene/fastp PEAKachu peak calling tool Bischler et al.92 https://github.com/tbischler/PEAKachu UMI-tools Smith et al.93 https://github.com/CGATOxford/UMI-tools Burrows-Wheeler Aligner (BWA) Li and Durbin94 https://bio-bwa.sourceforge.net/ BEDTools Quinlan and Hall95 https://github.com/arq5x/bedtools2/ releases Integrative Genomics Viewer (IGV) Thorvaldsdottir et al.96 https://igv.org/doc/desktop/ CHOPCHOP Labun et al.97 https://chopchop.cbu.uib.no/

    Silver Staining:

    Article Title: TRMT1L-catalyzed m 2 2 G27 on tyrosine tRNA is required for efficient mRNA translation and cell survival under oxidative stress.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-PELP1 Antibody Bethyl Cat#A300-180A; RRID: AB_242526 Rabbit anti-TRMT1L Antibody Bethyl Cat#A305-120A; RRID: AB_2631515 Mouse anti-TRMT1L Antibody Sigma-Aldrich Cat#SAB1408048; RRID: AB_10741695 Rabbit anti-SENP3 Antibody Cell Signaling Technology Cat#5591; RRID: AB_10694546 Rabbit anti-WDR18 Antibody Castle et al.25 N/A Mouse anti-NPM1 Antibody Santa Cruz Biotechnology Cat#sc-56622; RRID: AB_784888 Mouse anti-uL5 (RPL11) Antibody Sigma-Aldrich Cat#SAB1402896; RRID: AB_10738164 Mouse c-Myc Antibody (9E10) Santa Cruz Biotechnology Cat#sc-40; RRID: AB_627268 Rabbit anti-TRMT1 Antibody Bethyl Cat#A304-205A; RRID: AB_2620402 Rabbit anti-Fibrillarin Antibody Bethyl Cat#A303-891A; RRID: AB_2620241 Rabbit anti-DDX21 Antibody Bethyl Cat#A300-627A; RRID: AB_513601 Rabbit anti-N2,N2-dimethylguanosine (m2,2G) Antibody Abcam Cat#ab211488; RRID: AB_3532174 Rabbit IgG Normal Millipore Cat#NI01; RRID: AB_490574 Mouse anti-GAPDH Antibody Santa Cruz Biotechnology Cat#sc-47724; RRID: AB_627678 Mouse anti-puromycin antibody DSHB Cat#PMY-2A4; RRID: AB_2619605 Goat anti-Mouse IgG (H + L) Secondary Antibody, Alexa FluorTM 488 Thermo Fisher Scientific Cat#A-11001; RRID: AB_2534069 Goat anti-Rabbit IgG (H + L) Secondary Antibody, Alexa FluorTM 594 Thermo Fisher Scientific Cat#A-11012; RRID: AB_2534079 Chemicals, peptides, and recombinant proteins Amersham Hybond N+ nylon membrane GE Healthcare RPN303B AMPure RNAClean XP beads Beckman Coulter A63987 AMV Reverse Transcriptase Promega M510A AMV Reverse Transcriptase 5X Reaction Buffer Promega M515A Aprotinin Fisher BP250310 AEBSF Fisher BP635-500 CX-5461 Cellagen Technologies C2954-2s DMEM (no glucose) Gibco 11966025 Exonuclease I NEB M0293S FastAP Thermosensitive Alkaline Phosphatase Thermo Scientific EF0651 Fetal bovine serum Hyclone SV30014.03 High glucose DMEM HyClone SH30022.01 Immun-Star AP substrate Bio-rad 1705018 Lipofectamine RNAi Max Invitrogen 13778150 Murine RNase inhibitor NEB M0314 Penicillin-Streptomycin Hyclone SH40003.01 Protease inhibitor cocktail Thermo Scientific 78437 Protinase K Invitrogen 46–7185 Protein G Dynabeads Invitrogen 10003D Puromycin Sigma P8833 pCp-Biotin Jena Bioscience NU-1706-Bio (Continued on next page) 18 Cell Reports 44, 115167, January 28, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant protein G Sepharose beads Invitrogen 101242 RNase T1 Thermo Scientific EN0541 Streptavidin-alkaline phosophatase conjugate Invitrogen 434322 Streptavidin Magnetic Beads NEB S1420S Streptavidin-IR800 LI-COR 926–32230 SYBR Gold Nucleic Acid Gel Stain Invitrogen S11494 Thapsigargin Sigma 586006 SuperScript IV Reverse Transcriptase Invitrogen 18090010 TRIzol reagent Invitrogen 15596026 Turbo DNase Invitrogen AM2239 TurboDNase buffer Invitrogen AM2238 T4 polynucleotide kinase NEB M0201S T4 polynucleotide kinase reaction buffer NEB B0201S T4 RNA ligase NEB M0204S T4 RNA ligase 2 NEB M0239S Leupeptin Fisher PI78435 [g-32P]ATP Perkin-Elmer NEG502A250UC Nitrocellulose membrane Bio-rad 1620115 anti-DYKDDDDK Magnetic Agarose Pierce A36797 3x DYKDDDDK Peptide Pierce A36805 MAXIscriptTM T7 Transcription Kit Invitrogen AM1312 S-adenosylmethionine (SAM) NEB B9003S Critical commercial assays EconoFit Macro-Prep DEAE columns BioRad 12009274 G50 spin column Cytiva 27533001 Q5 Site-Directed Mutagenesis Kit NEB E0554S Silver stain kit Pierce 24612 BCA assay kit Pierce 23225 Direct RNA Sequencing Kit Oxford Nanopore technologies SQK-RNA002 Monarch RNA Cleanup kit NEB T2030L Zymoclean Gel RNA Recovery Kit Zymo research R1011 Deposited data eCLIP-seq raw and analyzed data This paper GEO: GSE266587 Nano-tRNAseq raw and analyzed data This paper GEO: GSE266588 Proteomic analysis of PELP1 (RIX1) interactome This paper MassIVE: MSV000096583 Experimental models: Cell lines HCT116 ATCC CatCCL-247; RRID: CVCL_0291 HeLa ATCC Cat#CCL-2; RRID: CVCL_0030 HT-1080 ATCC Cat#CCL-121; RRID: CVCL_0317 U2OS ATCC Cat#HTB-96; RRID: CVCL_0042 HEK293T ATCC Cat#CRL-3216; RRID: CVCL_0063 HCT116-WT (non-targeting sgRNA) This study N/A HCT116-TRMT1L KO#1 (TRMT1L sgRNA-1) This study N/A HCT116-TRMT1L KO#2 (TRMT1L sgRNA-2) This study N/A HCT116-WT (non-targeting sgRNA)+Empty This study N/A (Continued on next page) Cell Reports 44, 115167, January 28, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER HCT116-TRMT1L KO#1+Empty This study N/A HCT116-TRMT1L KO#1+TRMT1L WT This study N/A HCT116-TRMT1L KO#1+TRMT1L D373V This study N/A Oligonucleotides See Table S4 for oligonucleotides This study N/A Recombinant DNA pLentiCRISPR v2 Sanjana et al.83 Addgene plasmid #52961; http://n2t.net/ addgene:52961; RRID: Addgene_52961 pCMV-Myc Clontech Cat#631604 pLenti-CMV-GFP-Hygro Campeau et al.84 Addgene plasmid #17446; http://n2t.net/ addgene:17446; RRID: Addgene_17446 p3XFLAG-CMV-7.1 Sigma Cat#E7533 pCMV-Myc-TRMT1L This study N/A pCMV-Myc-TRMT1L mNLS This study N/A pCMV-Myc-TRMT1L mNoLS This study N/A pLenti-CMV-TRMT1L-Hygro This study N/A pLenti-CMV-TRMT1L D373V-Hygro This study N/A pLenti-CMV-Empty-Hygro This study N/A p3xFLAG-CMV-TRMT1L This study N/A p3xFLAG-CMV-TRMT1L D373V This study N/A plentiCRISPR v2-non targeting sgRNA This study N/A plentiCRISPR v2-TRMT1L sgRNA-1 This study N/A plentiCRISPR v2-TRMT1L sgRNA-2 This study N/A Software and algorithms ImageJ Schneider et al.85 https://imagej.net/software/fiji/ Bowtie2 Langmead and Salzberg86 http://bowtie-bio.sourceforge.net/bowtie2/ index.shtml Samtools Li & Li et al.87,88 http://samtools.sourceforge.net/ cNLS Mapper Kosugi et al.29 https://nls-mapper.iab.keio.ac.jp/cgi-bin/ NLS_Mapper_form.cgi NoD tool Scott et al. & Scott et al.27,28 https://www.compbio.dundee.ac.uk/www- nod/ Mongo Oligo Mass Calculator v2.06 Rozenski et al.89 http://rna.rega.kuleuven.be/masspec/ mongo.htm CutAdapt Martin90 https://cutadapt.readthedocs.io/en/stable/ fastp Chen et al.91 https://github.com/OpenGene/fastp PEAKachu peak calling tool Bischler et al.92 https://github.com/tbischler/PEAKachu UMI-tools Smith et al.93 https://github.com/CGATOxford/UMI-tools Burrows-Wheeler Aligner (BWA) Li and Durbin94 https://bio-bwa.sourceforge.net/ BEDTools Quinlan and Hall95 https://github.com/arq5x/bedtools2/ releases Integrative Genomics Viewer (IGV) Thorvaldsdottir et al.96 https://igv.org/doc/desktop/ CHOPCHOP Labun et al.97 https://chopchop.cbu.uib.no/

    BIA-KA:

    Article Title: TRMT1L-catalyzed m 2 2 G27 on tyrosine tRNA is required for efficient mRNA translation and cell survival under oxidative stress.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-PELP1 Antibody Bethyl Cat#A300-180A; RRID: AB_242526 Rabbit anti-TRMT1L Antibody Bethyl Cat#A305-120A; RRID: AB_2631515 Mouse anti-TRMT1L Antibody Sigma-Aldrich Cat#SAB1408048; RRID: AB_10741695 Rabbit anti-SENP3 Antibody Cell Signaling Technology Cat#5591; RRID: AB_10694546 Rabbit anti-WDR18 Antibody Castle et al.25 N/A Mouse anti-NPM1 Antibody Santa Cruz Biotechnology Cat#sc-56622; RRID: AB_784888 Mouse anti-uL5 (RPL11) Antibody Sigma-Aldrich Cat#SAB1402896; RRID: AB_10738164 Mouse c-Myc Antibody (9E10) Santa Cruz Biotechnology Cat#sc-40; RRID: AB_627268 Rabbit anti-TRMT1 Antibody Bethyl Cat#A304-205A; RRID: AB_2620402 Rabbit anti-Fibrillarin Antibody Bethyl Cat#A303-891A; RRID: AB_2620241 Rabbit anti-DDX21 Antibody Bethyl Cat#A300-627A; RRID: AB_513601 Rabbit anti-N2,N2-dimethylguanosine (m2,2G) Antibody Abcam Cat#ab211488; RRID: AB_3532174 Rabbit IgG Normal Millipore Cat#NI01; RRID: AB_490574 Mouse anti-GAPDH Antibody Santa Cruz Biotechnology Cat#sc-47724; RRID: AB_627678 Mouse anti-puromycin antibody DSHB Cat#PMY-2A4; RRID: AB_2619605 Goat anti-Mouse IgG (H + L) Secondary Antibody, Alexa FluorTM 488 Thermo Fisher Scientific Cat#A-11001; RRID: AB_2534069 Goat anti-Rabbit IgG (H + L) Secondary Antibody, Alexa FluorTM 594 Thermo Fisher Scientific Cat#A-11012; RRID: AB_2534079 Chemicals, peptides, and recombinant proteins Amersham Hybond N+ nylon membrane GE Healthcare RPN303B AMPure RNAClean XP beads Beckman Coulter A63987 AMV Reverse Transcriptase Promega M510A AMV Reverse Transcriptase 5X Reaction Buffer Promega M515A Aprotinin Fisher BP250310 AEBSF Fisher BP635-500 CX-5461 Cellagen Technologies C2954-2s DMEM (no glucose) Gibco 11966025 Exonuclease I NEB M0293S FastAP Thermosensitive Alkaline Phosphatase Thermo Scientific EF0651 Fetal bovine serum Hyclone SV30014.03 High glucose DMEM HyClone SH30022.01 Immun-Star AP substrate Bio-rad 1705018 Lipofectamine RNAi Max Invitrogen 13778150 Murine RNase inhibitor NEB M0314 Penicillin-Streptomycin Hyclone SH40003.01 Protease inhibitor cocktail Thermo Scientific 78437 Protinase K Invitrogen 46–7185 Protein G Dynabeads Invitrogen 10003D Puromycin Sigma P8833 pCp-Biotin Jena Bioscience NU-1706-Bio (Continued on next page) 18 Cell Reports 44, 115167, January 28, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant protein G Sepharose beads Invitrogen 101242 RNase T1 Thermo Scientific EN0541 Streptavidin-alkaline phosophatase conjugate Invitrogen 434322 Streptavidin Magnetic Beads NEB S1420S Streptavidin-IR800 LI-COR 926–32230 SYBR Gold Nucleic Acid Gel Stain Invitrogen S11494 Thapsigargin Sigma 586006 SuperScript IV Reverse Transcriptase Invitrogen 18090010 TRIzol reagent Invitrogen 15596026 Turbo DNase Invitrogen AM2239 TurboDNase buffer Invitrogen AM2238 T4 polynucleotide kinase NEB M0201S T4 polynucleotide kinase reaction buffer NEB B0201S T4 RNA ligase NEB M0204S T4 RNA ligase 2 NEB M0239S Leupeptin Fisher PI78435 [g-32P]ATP Perkin-Elmer NEG502A250UC Nitrocellulose membrane Bio-rad 1620115 anti-DYKDDDDK Magnetic Agarose Pierce A36797 3x DYKDDDDK Peptide Pierce A36805 MAXIscriptTM T7 Transcription Kit Invitrogen AM1312 S-adenosylmethionine (SAM) NEB B9003S Critical commercial assays EconoFit Macro-Prep DEAE columns BioRad 12009274 G50 spin column Cytiva 27533001 Q5 Site-Directed Mutagenesis Kit NEB E0554S Silver stain kit Pierce 24612 BCA assay kit Pierce 23225 Direct RNA Sequencing Kit Oxford Nanopore technologies SQK-RNA002 Monarch RNA Cleanup kit NEB T2030L Zymoclean Gel RNA Recovery Kit Zymo research R1011 Deposited data eCLIP-seq raw and analyzed data This paper GEO: GSE266587 Nano-tRNAseq raw and analyzed data This paper GEO: GSE266588 Proteomic analysis of PELP1 (RIX1) interactome This paper MassIVE: MSV000096583 Experimental models: Cell lines HCT116 ATCC CatCCL-247; RRID: CVCL_0291 HeLa ATCC Cat#CCL-2; RRID: CVCL_0030 HT-1080 ATCC Cat#CCL-121; RRID: CVCL_0317 U2OS ATCC Cat#HTB-96; RRID: CVCL_0042 HEK293T ATCC Cat#CRL-3216; RRID: CVCL_0063 HCT116-WT (non-targeting sgRNA) This study N/A HCT116-TRMT1L KO#1 (TRMT1L sgRNA-1) This study N/A HCT116-TRMT1L KO#2 (TRMT1L sgRNA-2) This study N/A HCT116-WT (non-targeting sgRNA)+Empty This study N/A (Continued on next page) Cell Reports 44, 115167, January 28, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER HCT116-TRMT1L KO#1+Empty This study N/A HCT116-TRMT1L KO#1+TRMT1L WT This study N/A HCT116-TRMT1L KO#1+TRMT1L D373V This study N/A Oligonucleotides See Table S4 for oligonucleotides This study N/A Recombinant DNA pLentiCRISPR v2 Sanjana et al.83 Addgene plasmid #52961; http://n2t.net/ addgene:52961; RRID: Addgene_52961 pCMV-Myc Clontech Cat#631604 pLenti-CMV-GFP-Hygro Campeau et al.84 Addgene plasmid #17446; http://n2t.net/ addgene:17446; RRID: Addgene_17446 p3XFLAG-CMV-7.1 Sigma Cat#E7533 pCMV-Myc-TRMT1L This study N/A pCMV-Myc-TRMT1L mNLS This study N/A pCMV-Myc-TRMT1L mNoLS This study N/A pLenti-CMV-TRMT1L-Hygro This study N/A pLenti-CMV-TRMT1L D373V-Hygro This study N/A pLenti-CMV-Empty-Hygro This study N/A p3xFLAG-CMV-TRMT1L This study N/A p3xFLAG-CMV-TRMT1L D373V This study N/A plentiCRISPR v2-non targeting sgRNA This study N/A plentiCRISPR v2-TRMT1L sgRNA-1 This study N/A plentiCRISPR v2-TRMT1L sgRNA-2 This study N/A Software and algorithms ImageJ Schneider et al.85 https://imagej.net/software/fiji/ Bowtie2 Langmead and Salzberg86 http://bowtie-bio.sourceforge.net/bowtie2/ index.shtml Samtools Li & Li et al.87,88 http://samtools.sourceforge.net/ cNLS Mapper Kosugi et al.29 https://nls-mapper.iab.keio.ac.jp/cgi-bin/ NLS_Mapper_form.cgi NoD tool Scott et al. & Scott et al.27,28 https://www.compbio.dundee.ac.uk/www- nod/ Mongo Oligo Mass Calculator v2.06 Rozenski et al.89 http://rna.rega.kuleuven.be/masspec/ mongo.htm CutAdapt Martin90 https://cutadapt.readthedocs.io/en/stable/ fastp Chen et al.91 https://github.com/OpenGene/fastp PEAKachu peak calling tool Bischler et al.92 https://github.com/tbischler/PEAKachu UMI-tools Smith et al.93 https://github.com/CGATOxford/UMI-tools Burrows-Wheeler Aligner (BWA) Li and Durbin94 https://bio-bwa.sourceforge.net/ BEDTools Quinlan and Hall95 https://github.com/arq5x/bedtools2/ releases Integrative Genomics Viewer (IGV) Thorvaldsdottir et al.96 https://igv.org/doc/desktop/ CHOPCHOP Labun et al.97 https://chopchop.cbu.uib.no/

    RNA Sequencing:

    Article Title: TRMT1L-catalyzed m 2 2 G27 on tyrosine tRNA is required for efficient mRNA translation and cell survival under oxidative stress.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit anti-PELP1 Antibody Bethyl Cat#A300-180A; RRID: AB_242526 Rabbit anti-TRMT1L Antibody Bethyl Cat#A305-120A; RRID: AB_2631515 Mouse anti-TRMT1L Antibody Sigma-Aldrich Cat#SAB1408048; RRID: AB_10741695 Rabbit anti-SENP3 Antibody Cell Signaling Technology Cat#5591; RRID: AB_10694546 Rabbit anti-WDR18 Antibody Castle et al.25 N/A Mouse anti-NPM1 Antibody Santa Cruz Biotechnology Cat#sc-56622; RRID: AB_784888 Mouse anti-uL5 (RPL11) Antibody Sigma-Aldrich Cat#SAB1402896; RRID: AB_10738164 Mouse c-Myc Antibody (9E10) Santa Cruz Biotechnology Cat#sc-40; RRID: AB_627268 Rabbit anti-TRMT1 Antibody Bethyl Cat#A304-205A; RRID: AB_2620402 Rabbit anti-Fibrillarin Antibody Bethyl Cat#A303-891A; RRID: AB_2620241 Rabbit anti-DDX21 Antibody Bethyl Cat#A300-627A; RRID: AB_513601 Rabbit anti-N2,N2-dimethylguanosine (m2,2G) Antibody Abcam Cat#ab211488; RRID: AB_3532174 Rabbit IgG Normal Millipore Cat#NI01; RRID: AB_490574 Mouse anti-GAPDH Antibody Santa Cruz Biotechnology Cat#sc-47724; RRID: AB_627678 Mouse anti-puromycin antibody DSHB Cat#PMY-2A4; RRID: AB_2619605 Goat anti-Mouse IgG (H + L) Secondary Antibody, Alexa FluorTM 488 Thermo Fisher Scientific Cat#A-11001; RRID: AB_2534069 Goat anti-Rabbit IgG (H + L) Secondary Antibody, Alexa FluorTM 594 Thermo Fisher Scientific Cat#A-11012; RRID: AB_2534079 Chemicals, peptides, and recombinant proteins Amersham Hybond N+ nylon membrane GE Healthcare RPN303B AMPure RNAClean XP beads Beckman Coulter A63987 AMV Reverse Transcriptase Promega M510A AMV Reverse Transcriptase 5X Reaction Buffer Promega M515A Aprotinin Fisher BP250310 AEBSF Fisher BP635-500 CX-5461 Cellagen Technologies C2954-2s DMEM (no glucose) Gibco 11966025 Exonuclease I NEB M0293S FastAP Thermosensitive Alkaline Phosphatase Thermo Scientific EF0651 Fetal bovine serum Hyclone SV30014.03 High glucose DMEM HyClone SH30022.01 Immun-Star AP substrate Bio-rad 1705018 Lipofectamine RNAi Max Invitrogen 13778150 Murine RNase inhibitor NEB M0314 Penicillin-Streptomycin Hyclone SH40003.01 Protease inhibitor cocktail Thermo Scientific 78437 Protinase K Invitrogen 46–7185 Protein G Dynabeads Invitrogen 10003D Puromycin Sigma P8833 pCp-Biotin Jena Bioscience NU-1706-Bio (Continued on next page) 18 Cell Reports 44, 115167, January 28, 2025 .. REAGENT or RESOURCE SOURCE IDENTIFIER Recombinant protein G Sepharose beads Invitrogen 101242 RNase T1 Thermo Scientific EN0541 Streptavidin-alkaline phosophatase conjugate Invitrogen 434322 Streptavidin Magnetic Beads NEB S1420S Streptavidin-IR800 LI-COR 926–32230 SYBR Gold Nucleic Acid Gel Stain Invitrogen S11494 Thapsigargin Sigma 586006 SuperScript IV Reverse Transcriptase Invitrogen 18090010 TRIzol reagent Invitrogen 15596026 Turbo DNase Invitrogen AM2239 TurboDNase buffer Invitrogen AM2238 T4 polynucleotide kinase NEB M0201S T4 polynucleotide kinase reaction buffer NEB B0201S T4 RNA ligase NEB M0204S T4 RNA ligase 2 NEB M0239S Leupeptin Fisher PI78435 [g-32P]ATP Perkin-Elmer NEG502A250UC Nitrocellulose membrane Bio-rad 1620115 anti-DYKDDDDK Magnetic Agarose Pierce A36797 3x DYKDDDDK Peptide Pierce A36805 MAXIscriptTM T7 Transcription Kit Invitrogen AM1312 S-adenosylmethionine (SAM) NEB B9003S Critical commercial assays EconoFit Macro-Prep DEAE columns BioRad 12009274 G50 spin column Cytiva 27533001 Q5 Site-Directed Mutagenesis Kit NEB E0554S Silver stain kit Pierce 24612 BCA assay kit Pierce 23225 Direct RNA Sequencing Kit Oxford Nanopore technologies SQK-RNA002 Monarch RNA Cleanup kit NEB T2030L Zymoclean Gel RNA Recovery Kit Zymo research R1011 Deposited data eCLIP-seq raw and analyzed data This paper GEO: GSE266587 Nano-tRNAseq raw and analyzed data This paper GEO: GSE266588 Proteomic analysis of PELP1 (RIX1) interactome This paper MassIVE: MSV000096583 Experimental models: Cell lines HCT116 ATCC CatCCL-247; RRID: CVCL_0291 HeLa ATCC Cat#CCL-2; RRID: CVCL_0030 HT-1080 ATCC Cat#CCL-121; RRID: CVCL_0317 U2OS ATCC Cat#HTB-96; RRID: CVCL_0042 HEK293T ATCC Cat#CRL-3216; RRID: CVCL_0063 HCT116-WT (non-targeting sgRNA) This study N/A HCT116-TRMT1L KO#1 (TRMT1L sgRNA-1) This study N/A HCT116-TRMT1L KO#2 (TRMT1L sgRNA-2) This study N/A HCT116-WT (non-targeting sgRNA)+Empty This study N/A (Continued on next page) Cell Reports 44, 115167, January 28, 2025 19 .. REAGENT or RESOURCE SOURCE IDENTIFIER HCT116-TRMT1L KO#1+Empty This study N/A HCT116-TRMT1L KO#1+TRMT1L WT This study N/A HCT116-TRMT1L KO#1+TRMT1L D373V This study N/A Oligonucleotides See Table S4 for oligonucleotides This study N/A Recombinant DNA pLentiCRISPR v2 Sanjana et al.83 Addgene plasmid #52961; http://n2t.net/ addgene:52961; RRID: Addgene_52961 pCMV-Myc Clontech Cat#631604 pLenti-CMV-GFP-Hygro Campeau et al.84 Addgene plasmid #17446; http://n2t.net/ addgene:17446; RRID: Addgene_17446 p3XFLAG-CMV-7.1 Sigma Cat#E7533 pCMV-Myc-TRMT1L This study N/A pCMV-Myc-TRMT1L mNLS This study N/A pCMV-Myc-TRMT1L mNoLS This study N/A pLenti-CMV-TRMT1L-Hygro This study N/A pLenti-CMV-TRMT1L D373V-Hygro This study N/A pLenti-CMV-Empty-Hygro This study N/A p3xFLAG-CMV-TRMT1L This study N/A p3xFLAG-CMV-TRMT1L D373V This study N/A plentiCRISPR v2-non targeting sgRNA This study N/A plentiCRISPR v2-TRMT1L sgRNA-1 This study N/A plentiCRISPR v2-TRMT1L sgRNA-2 This study N/A Software and algorithms ImageJ Schneider et al.85 https://imagej.net/software/fiji/ Bowtie2 Langmead and Salzberg86 http://bowtie-bio.sourceforge.net/bowtie2/ index.shtml Samtools Li & Li et al.87,88 http://samtools.sourceforge.net/ cNLS Mapper Kosugi et al.29 https://nls-mapper.iab.keio.ac.jp/cgi-bin/ NLS_Mapper_form.cgi NoD tool Scott et al. & Scott et al.27,28 https://www.compbio.dundee.ac.uk/www- nod/ Mongo Oligo Mass Calculator v2.06 Rozenski et al.89 http://rna.rega.kuleuven.be/masspec/ mongo.htm CutAdapt Martin90 https://cutadapt.readthedocs.io/en/stable/ fastp Chen et al.91 https://github.com/OpenGene/fastp PEAKachu peak calling tool Bischler et al.92 https://github.com/tbischler/PEAKachu UMI-tools Smith et al.93 https://github.com/CGATOxford/UMI-tools Burrows-Wheeler Aligner (BWA) Li and Durbin94 https://bio-bwa.sourceforge.net/ BEDTools Quinlan and Hall95 https://github.com/arq5x/bedtools2/ releases Integrative Genomics Viewer (IGV) Thorvaldsdottir et al.96 https://igv.org/doc/desktop/ CHOPCHOP Labun et al.97 https://chopchop.cbu.uib.no/



    Similar Products

    cell lines hct116 atcc cat  (ATCC)
    97
    ATCC cell lines hct116 atcc cat
    Cell Lines Hct116 Atcc Cat, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+hct116+atcc+cat/RKO/pm41630900-172-147-150
    Average 97 stars, based on 1 article reviews
    cell lines hct116 atcc cat - by Bioz Stars, 2026-09
    97/100 stars
    		  Buy from Supplier
    cell lines hek 293t dr joshua mendell rrid cvcl 0063 hct116 atcc cat  (ATCC)
    99
    ATCC cell lines hek 293t dr joshua mendell rrid cvcl 0063 hct116 atcc cat
    Cell Lines Hek 293t Dr Joshua Mendell Rrid Cvcl 0063 Hct116 Atcc Cat, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+hct116+atcc+cat/293T/pm40644296-344-145-155
    Average 99 stars, based on 1 article reviews
    cell lines hek 293t dr joshua mendell rrid cvcl 0063 hct116 atcc cat - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    cell lines human hct116 atcc cat  (ATCC)
    99
    ATCC cell lines human hct116 atcc cat
    Cell Lines Human Hct116 Atcc Cat, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+hct116+atcc+cat/HCT+116/pm37413987-559-108-111
    Average 99 stars, based on 1 article reviews
    cell lines human hct116 atcc cat - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier
    cell lines hct116 human colorectal carcinoma cell line atcc cat  (ATCC)
    99
    ATCC cell lines hct116 human colorectal carcinoma cell line atcc cat
    Cell Lines Hct116 Human Colorectal Carcinoma Cell Line Atcc Cat, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/cell+lines+hct116+atcc+cat/HCT+116/pm36476850-553-49-57
    Average 99 stars, based on 1 article reviews
    cell lines hct116 human colorectal carcinoma cell line atcc cat - by Bioz Stars, 2026-09
    99/100 stars
    		  Buy from Supplier

    Image Search Results